EMAIL THIS PAGE TO A FRIEND

TAF9

TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa

Synonyms: AK6 CGI-137 CINAP CIP MGC:1603 MGC:3647 MGC:5067 STAF31/32 TAF2G TAFII-31 TAFII-32 TAFII31 TAFII32 TAFIID32 hCINAP
UniProtKB ID: Q16594, D3DWA3, Q5U0D1, Q9BTS1
Gene ID:
Human(6880) Summary: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the smaller subunits of TFIID that binds to the basal transcription factor GTF2B as well as to several transcriptional activators such as p53 and VP16. A similar but distinct gene (TAF9L) has been found on the X chromosome and a pseudogene has been identified on chromosome 19. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(108143) TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(373541) TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor
Zebrafish(321485) TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor
dog(480815) TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
chicken(422152) TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
cow(532936) TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
sheep(101119251) TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
naked mole-rat(101701988) TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
domestic guinea pig(100725685) TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003187 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_027139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015891 Rosetta Predictions human pricing
NM_001015892 Rosetta Predictions human pricing
NM_003187 Rosetta Predictions human pricing
NM_016283 Rosetta Predictions human pricing
NM_001012463 Rosetta Predictions rat pricing
NM_001037310 Rosetta Predictions rat pricing
NM_184048 Rosetta Predictions rat pricing
NM_001015889 Rosetta Predictions mouse pricing
NM_027139 Rosetta Predictions mouse pricing
NM_027592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141328 predicted 747
2 SASI_Hs01_00141329 predicted 750
3 SASI_Hs01_00141330 predicted 663
4 SASI_Hs01_00141331 predicted 854
5 SASI_Hs01_00141332 predicted 795
6 SASI_Hs01_00141333 predicted 806
7 SASI_Hs01_00141334 predicted 622
8 SASI_Hs02_00306677 predicted 601
9 SASI_Hs01_00141336 predicted 658
10 SASI_Hs01_00141337 predicted 571
11 SASI_Hs01_00141335 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162306 predicted 798
2 SASI_Hs01_00162307 predicted 555
3 SASI_Hs01_00162309 predicted 595
4 SASI_Hs01_00162311 predicted 609
5 SASI_Hs01_00162312 predicted 867
6 SASI_Hs01_00162313 predicted 582
7 SASI_Hs01_00162314 predicted 664
8 SASI_Hs01_00162315 predicted 639
9 SASI_Hs02_00306678 predicted 600
10 SASI_Hs02_00306679 predicted 969
11 SASI_Hs01_00162308 predicted 870
12 SASI_Hs01_00162310 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054542 predicted 562
2 SASI_Hs01_00054543 predicted 319
3 SASI_Hs01_00054545 predicted 355
4 SASI_Hs01_00054547 predicted 371
5 SASI_Hs01_00054548 predicted 636
6 SASI_Hs01_00054549 predicted 344
7 SASI_Hs01_00054550 predicted 434
8 SASI_Hs01_00054551 predicted 406
9 SASI_Hs02_00335225 predicted 361
10 SASI_Hs02_00335226 predicted 730
11 SASI_Hs01_00054544 predicted 634
12 SASI_Hs01_00054546 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205511 predicted 506
2 SASI_Hs01_00205512 predicted 508
3 SASI_Hs01_00205513 predicted 425
4 SASI_Hs01_00205514 predicted 610
5 SASI_Hs01_00205515 predicted 552
6 SASI_Hs01_00205516 predicted 575
7 SASI_Hs01_00205517 predicted 382
8 SASI_Hs02_00349199 predicted 368
9 SASI_Hs01_00205519 predicted 425
10 SASI_Hs01_00205520 predicted 335
11 SASI_Hs01_00205518 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116584 predicted 265
2 SASI_Rn01_00116585 predicted 540
3 SASI_Rn02_00200560 predicted 688
4 SASI_Rn02_00200561 predicted 442
5 SASI_Rn01_00116587 predicted 605
6 SASI_Rn02_00200562 predicted 280
7 SASI_Rn02_00200563 predicted 733
8 SASI_Rn01_00116591 predicted 305
9 SASI_Rn02_00200564 predicted 496
10 SASI_Rn01_00116593 predicted 223
11 SASI_Rn01_00116586 predicted 725
12 SASI_Rn01_00116588 predicted 248
13 SASI_Rn01_00116589 predicted 685
14 SASI_Rn01_00116590 predicted 246
15 SASI_Rn01_00116592 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037310 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116769 predicted 763
2 SASI_Rn01_00116770 predicted 1093
3 SASI_Rn01_00116771 predicted 1171
4 SASI_Rn01_00116772 predicted 1084
5 SASI_Rn01_00116773 predicted 1173
6 SASI_Rn01_00116774 predicted 1073
7 SASI_Rn01_00116775 predicted 1038
8 SASI_Rn01_00116776 predicted 1194
9 SASI_Rn01_00116777 predicted 1120
10 SASI_Rn01_00116778 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114549 predicted 280
2 SASI_Rn01_00114550 predicted 617
3 SASI_Rn01_00114551 predicted 688
4 SASI_Rn01_00114552 predicted 607
5 SASI_Rn01_00114553 predicted 690
6 SASI_Rn01_00114554 predicted 598
7 SASI_Rn01_00114555 predicted 559
8 SASI_Rn01_00114556 predicted 711
9 SASI_Rn01_00114557 predicted 645
10 SASI_Rn01_00114558 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287463 predicted 565
2 SASI_Mm02_00287464 predicted 310
3 SASI_Mm02_00287465 predicted 650
4 SASI_Mm02_00287466 predicted 642
5 SASI_Mm02_00287467 predicted 242
6 SASI_Mm02_00287468 predicted 548
7 SASI_Mm02_00287469 predicted 334
8 SASI_Mm02_00287470 predicted 264
9 SASI_Mm02_00287471 predicted 257
10 SASI_Mm02_00287472 predicted 655
11 SASI_Mm01_00046304 predicted 480
12 SASI_Mm01_00046305 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021072 predicted 555
2 SASI_Mm01_00021073 predicted 306
3 SASI_Mm01_00021074 predicted 471
4 SASI_Mm02_00331638 predicted 637
5 SASI_Mm01_00021075 predicted 636
6 SASI_Mm01_00021076 predicted 548
7 SASI_Mm01_00021078 predicted 325
8 SASI_Mm01_00021079 predicted 531
9 SASI_Mm01_00021080 predicted 652
10 SASI_Mm02_00331639 predicted 713
11 SASI_Mm01_00021077 predicted 529
12 SASI_Mm01_00021081 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199925 predicted 460
2 SASI_Mm02_00332444 predicted 215
3 SASI_Mm02_00332445 predicted 215
4 SASI_Mm01_00199926 predicted 289
5 SASI_Mm01_00199927 predicted 325
6 SASI_Mm02_00332446 predicted 220
7 SASI_Mm01_00199932 predicted 367
8 SASI_Mm01_00199933 predicted 359
9 SASI_Mm01_00199934 predicted 253
10 SASI_Mm02_00332447 predicted 192
11 SASI_Mm01_00199928 predicted 313
12 SASI_Mm01_00199929 predicted 376
13 SASI_Mm01_00199930 predicted 290
14 SASI_Mm01_00199931 predicted 213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003187
TAF9 MISSION shRNA Bacterial Glycerol Stock
TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003187.4-772s21c1
Sequence:CCGGCCCTCACAGGTCAAAGGTTTACTCGAGTAAACCTTTGACCTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003187.4-864s21c1
Sequence:CCGGGTTCTGATTAATCCATCATTACTCGAGTAATGATGGATTAATCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003187.4-320s21c1
Sequence:CCGGATATGAGCCAAGAGTTATAAACTCGAGTTTATAACTCTTGGCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003187.4-358s21c1
Sequence:CCGGCCTTCCGATATGTGACCACAACTCGAGTTGTGGTCACATATCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003187.3-223s1c1
Sequence:CCGGGCCGAAAGATGCACAGATGATCTCGAGATCATCTGTGCATCTTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003187.3-315s1c1
Sequence:CCGGCCTTCCGATATGTGACCACAACTCGAGTTGTGGTCACATATCGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003187.3-729s1c1
Sequence:CCGGCCCTCACAGGTCAAAGGTTTACTCGAGTAAACCTTTGACCTGTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003187.3-833s1c1
Sequence:CCGGCCATCATTAATCGGGTCCAAACTCGAGTTTGGACCCGATTAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003187.3-988s1c1
Sequence:CCGGCCTTGCTGAATGTAACATGTACTCGAGTACATGTTACATTCAGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003187
TAF9 MISSION shRNA shRNA Plasmid DNA
TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003187.4-772s21c1
Sequence:CCGGCCCTCACAGGTCAAAGGTTTACTCGAGTAAACCTTTGACCTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003187.4-864s21c1
Sequence:CCGGGTTCTGATTAATCCATCATTACTCGAGTAATGATGGATTAATCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003187.4-320s21c1
Sequence:CCGGATATGAGCCAAGAGTTATAAACTCGAGTTTATAACTCTTGGCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003187.4-358s21c1
Sequence:CCGGCCTTCCGATATGTGACCACAACTCGAGTTGTGGTCACATATCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003187.3-223s1c1
Sequence:CCGGGCCGAAAGATGCACAGATGATCTCGAGATCATCTGTGCATCTTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003187.3-315s1c1
Sequence:CCGGCCTTCCGATATGTGACCACAACTCGAGTTGTGGTCACATATCGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003187.3-729s1c1
Sequence:CCGGCCCTCACAGGTCAAAGGTTTACTCGAGTAAACCTTTGACCTGTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003187.3-833s1c1
Sequence:CCGGCCATCATTAATCGGGTCCAAACTCGAGTTTGGACCCGATTAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003187.3-988s1c1
Sequence:CCGGCCTTGCTGAATGTAACATGTACTCGAGTACATGTTACATTCAGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003187
TAF9 MISSION shRNA Lentiviral Transduction Particles
TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003187.4-772s21c1
Sequence:CCGGCCCTCACAGGTCAAAGGTTTACTCGAGTAAACCTTTGACCTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003187.4-864s21c1
Sequence:CCGGGTTCTGATTAATCCATCATTACTCGAGTAATGATGGATTAATCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003187.4-320s21c1
Sequence:CCGGATATGAGCCAAGAGTTATAAACTCGAGTTTATAACTCTTGGCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003187.4-358s21c1
Sequence:CCGGCCTTCCGATATGTGACCACAACTCGAGTTGTGGTCACATATCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003187.3-223s1c1
Sequence:CCGGGCCGAAAGATGCACAGATGATCTCGAGATCATCTGTGCATCTTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003187.3-315s1c1
Sequence:CCGGCCTTCCGATATGTGACCACAACTCGAGTTGTGGTCACATATCGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003187.3-729s1c1
Sequence:CCGGCCCTCACAGGTCAAAGGTTTACTCGAGTAAACCTTTGACCTGTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003187.3-833s1c1
Sequence:CCGGCCATCATTAATCGGGTCCAAACTCGAGTTTGGACCCGATTAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003187.3-988s1c1
Sequence:CCGGCCTTGCTGAATGTAACATGTACTCGAGTACATGTTACATTCAGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027592
VALIDATED
TAF9 MISSION shRNA Bacterial Glycerol Stock
TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-626s21c1
Sequence:CCGGGTCCATCGTCCCAGATCTTAGCTCGAGCTAAGATCTGGGACGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-560s21c1
Sequence:CCGGGGATTGAGCAGTGGGTCAAAGCTCGAGCTTTGACCCACTGCTCAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-153s21c1
Sequence:CCGGATCAGGCCTGAAGTACGTTAACTCGAGTTAACGTACTTCAGGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-328s21c1
Sequence:CCGGCCCGAACGCTGGTTTCATATACTCGAGTATATGAAACCAGCGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-251s21c1
Sequence:CCGGATAGGGTTGTCGATGAGTTAGCTCGAGCTAACTCATCGACAACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027592.1-420s1c1
Sequence:CCGGGCCATAGCATCTTACAAAGAACTCGAGTTCTTTGTAAGATGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027592
VALIDATED
TAF9 MISSION shRNA shRNA Plasmid DNA
TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-626s21c1
Sequence:CCGGGTCCATCGTCCCAGATCTTAGCTCGAGCTAAGATCTGGGACGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-560s21c1
Sequence:CCGGGGATTGAGCAGTGGGTCAAAGCTCGAGCTTTGACCCACTGCTCAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-153s21c1
Sequence:CCGGATCAGGCCTGAAGTACGTTAACTCGAGTTAACGTACTTCAGGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-328s21c1
Sequence:CCGGCCCGAACGCTGGTTTCATATACTCGAGTATATGAAACCAGCGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-251s21c1
Sequence:CCGGATAGGGTTGTCGATGAGTTAGCTCGAGCTAACTCATCGACAACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027592.1-420s1c1
Sequence:CCGGGCCATAGCATCTTACAAAGAACTCGAGTTCTTTGTAAGATGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027592
VALIDATED
TAF9 MISSION shRNA Lentiviral Transduction Particles
TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-626s21c1
Sequence:CCGGGTCCATCGTCCCAGATCTTAGCTCGAGCTAAGATCTGGGACGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-560s21c1
Sequence:CCGGGGATTGAGCAGTGGGTCAAAGCTCGAGCTTTGACCCACTGCTCAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-153s21c1
Sequence:CCGGATCAGGCCTGAAGTACGTTAACTCGAGTTAACGTACTTCAGGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-328s21c1
Sequence:CCGGCCCGAACGCTGGTTTCATATACTCGAGTATATGAAACCAGCGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027592.2-251s21c1
Sequence:CCGGATAGGGTTGTCGATGAGTTAGCTCGAGCTAACTCATCGACAACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027592.1-420s1c1
Sequence:CCGGGCCATAGCATCTTACAAAGAACTCGAGTTCTTTGTAAGATGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027139
TAF9 MISSION shRNA Bacterial Glycerol Stock
TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-834s1c1
Sequence:CCGGCCATCGTTAATTGGGTCCAAACTCGAGTTTGGACCCAATTAACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-450s1c1
Sequence:CCGGCCGAGAGATTTCTTATTAGATCTCGAGATCTAATAAGAAATCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-896s1c1
Sequence:CCGGCGAGTCAGCAAATGCACTGAACTCGAGTTCAGTGCATTTGCTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-640s1c1
Sequence:CCGGGTTCAGTTTCTAGTAGACCAACTCGAGTTGGTCTACTAGAAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-361s1c1
Sequence:CCGGCCAGCCATGCTAAGAAAGCTACTCGAGTAGCTTTCTTAGCATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027139
TAF9 MISSION shRNA shRNA Plasmid DNA
TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-834s1c1
Sequence:CCGGCCATCGTTAATTGGGTCCAAACTCGAGTTTGGACCCAATTAACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-450s1c1
Sequence:CCGGCCGAGAGATTTCTTATTAGATCTCGAGATCTAATAAGAAATCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-896s1c1
Sequence:CCGGCGAGTCAGCAAATGCACTGAACTCGAGTTCAGTGCATTTGCTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-640s1c1
Sequence:CCGGGTTCAGTTTCTAGTAGACCAACTCGAGTTGGTCTACTAGAAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-361s1c1
Sequence:CCGGCCAGCCATGCTAAGAAAGCTACTCGAGTAGCTTTCTTAGCATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027139
TAF9 MISSION shRNA Lentiviral Transduction Particles
TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-834s1c1
Sequence:CCGGCCATCGTTAATTGGGTCCAAACTCGAGTTTGGACCCAATTAACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-450s1c1
Sequence:CCGGCCGAGAGATTTCTTATTAGATCTCGAGATCTAATAAGAAATCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-896s1c1
Sequence:CCGGCGAGTCAGCAAATGCACTGAACTCGAGTTCAGTGCATTTGCTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-640s1c1
Sequence:CCGGGTTCAGTTTCTAGTAGACCAACTCGAGTTGGTCTACTAGAAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027139.3-361s1c1
Sequence:CCGGCCAGCCATGCTAAGAAAGCTACTCGAGTAGCTTTCTTAGCATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks