EMAIL THIS PAGE TO A FRIEND

TAF9B

TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa

Synonyms: DN-7 DN7 TAF9L TAFII31L TFIID-31
UniProtKB ID: Q9HBM6, B2RUZ9, Q9Y2S3
Gene ID:
Human(51616) Summary: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a protein that is similar to one of the small subunits of TFIID, TBP-associated factor 9, and is also a subunit of TFIID. TAF9 and TAF9b share some functions but also have distinct roles in the transcriptional regulatory process. [provided by RefSeq, Jul 2008]
Mouse(407786) TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor
Rat(171152) TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor
domestic guinea pig(100722544) TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
naked mole-rat(101713803) TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
cow(538983) TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
sheep(101117906) TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
domestic cat(101087456) TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
dog(480965) TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
177 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015975 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015975 Rosetta Predictions human pricing
NM_133615 Rosetta Predictions rat pricing
NM_001001176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185532 predicted 889
2 SASI_Hs01_00185535 predicted 595
3 SASI_Hs01_00185536 predicted 524
4 SASI_Hs02_00348644 predicted 886
5 SASI_Hs01_00185539 predicted 391
6 SASI_Hs01_00185540 predicted 650
7 SASI_Hs02_00348645 predicted 697
8 SASI_Hs01_00185541 predicted 448
9 SASI_Hs02_00348646 predicted 874
10 SASI_Hs02_00348647 predicted 870
11 SASI_Hs01_00185533 predicted 692
12 SASI_Hs01_00185534 predicted 591
13 SASI_Hs01_00185537 predicted 518
14 SASI_Hs01_00185538 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103650 predicted 1112
2 SASI_Rn01_00103651 predicted 991
3 SASI_Rn01_00103652 predicted 441
4 SASI_Rn01_00103653 predicted 1056
5 SASI_Rn02_00267840 predicted 1139
6 SASI_Rn01_00103654 predicted 1272
7 SASI_Rn01_00103655 predicted 1230
8 SASI_Rn01_00103656 predicted 488
9 SASI_Rn01_00103657 predicted 1036
10 SASI_Rn01_00103658 predicted 374
11 SASI_Rn01_00103659 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103244 predicted 793
2 SASI_Mm02_00286076 predicted 448
3 SASI_Mm01_00103245 predicted 615
4 SASI_Mm01_00103246 predicted 821
5 SASI_Mm01_00103247 predicted 803
6 SASI_Mm01_00103248 predicted 359
7 SASI_Mm01_00103250 predicted 485
8 SASI_Mm01_00103251 predicted 412
9 SASI_Mm01_00103252 predicted 622
10 SASI_Mm01_00103253 predicted 345
11 SASI_Mm01_00103249 predicted 841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015975
TAF9B MISSION shRNA Bacterial Glycerol Stock
TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-548s1c1
Sequence:CCGGGCAAACCTACTACTCCTACTACTCGAGTAGTAGGAGTAGTAGGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-721s1c1
Sequence:CCGGCCTTCAATGATTGGGCCCAAACTCGAGTTTGGGCCCAATCATTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-207s1c1
Sequence:CCGGGTTGGAATTTGCTTTCCGTTACTCGAGTAACGGAAAGCAAATTCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-523s1c1
Sequence:CCGGCGATTAAGTGTTGGTGCTGTTCTCGAGAACAGCACCAACACTTAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-630s1c1
Sequence:CCGGCCAAAGATTTACGGTGCAGATCTCGAGATCTGCACCGTAAATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015975.4-450s21c1
Sequence:CCGGTATAGGCTGAAGTCCTTAATTCTCGAGAATTAAGGACTTCAGCCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015975.4-160s21c1
Sequence:CCGGAGTATGAACCAAGGGTTATAACTCGAGTTATAACCCTTGGTTCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015975
TAF9B MISSION shRNA shRNA Plasmid DNA
TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-548s1c1
Sequence:CCGGGCAAACCTACTACTCCTACTACTCGAGTAGTAGGAGTAGTAGGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-721s1c1
Sequence:CCGGCCTTCAATGATTGGGCCCAAACTCGAGTTTGGGCCCAATCATTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-207s1c1
Sequence:CCGGGTTGGAATTTGCTTTCCGTTACTCGAGTAACGGAAAGCAAATTCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-523s1c1
Sequence:CCGGCGATTAAGTGTTGGTGCTGTTCTCGAGAACAGCACCAACACTTAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-630s1c1
Sequence:CCGGCCAAAGATTTACGGTGCAGATCTCGAGATCTGCACCGTAAATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015975.4-450s21c1
Sequence:CCGGTATAGGCTGAAGTCCTTAATTCTCGAGAATTAAGGACTTCAGCCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015975.4-160s21c1
Sequence:CCGGAGTATGAACCAAGGGTTATAACTCGAGTTATAACCCTTGGTTCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015975
TAF9B MISSION shRNA Lentiviral Transduction Particles
TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-548s1c1
Sequence:CCGGGCAAACCTACTACTCCTACTACTCGAGTAGTAGGAGTAGTAGGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-721s1c1
Sequence:CCGGCCTTCAATGATTGGGCCCAAACTCGAGTTTGGGCCCAATCATTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-207s1c1
Sequence:CCGGGTTGGAATTTGCTTTCCGTTACTCGAGTAACGGAAAGCAAATTCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-523s1c1
Sequence:CCGGCGATTAAGTGTTGGTGCTGTTCTCGAGAACAGCACCAACACTTAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015975.3-630s1c1
Sequence:CCGGCCAAAGATTTACGGTGCAGATCTCGAGATCTGCACCGTAAATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015975.4-450s21c1
Sequence:CCGGTATAGGCTGAAGTCCTTAATTCTCGAGAATTAAGGACTTCAGCCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015975.4-160s21c1
Sequence:CCGGAGTATGAACCAAGGGTTATAACTCGAGTTATAACCCTTGGTTCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001176
TAF9B MISSION shRNA Bacterial Glycerol Stock
TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001176.1-1538s1c1
Sequence:CCGGCCACTAAAGAACTTTGTTGTTCTCGAGAACAACAAAGTTCTTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001176.1-447s1c1
Sequence:CCGGCGGTCAGTAGTAGACCAACTACTCGAGTAGTTGGTCTACTACTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001176.1-147s1c1
Sequence:CCGGCTACAATTCTGGACGATGCAACTCGAGTTGCATCGTCCAGAATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001176.1-707s1c1
Sequence:CCGGCCACTGAAGAGGAAGCATGATCTCGAGATCATGCTTCCTCTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001176.1-164s1c1
Sequence:CCGGGCAAAGATTTATTCGAGTCATCTCGAGATGACTCGAATAAATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001176
TAF9B MISSION shRNA shRNA Plasmid DNA
TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001176.1-1538s1c1
Sequence:CCGGCCACTAAAGAACTTTGTTGTTCTCGAGAACAACAAAGTTCTTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001176.1-447s1c1
Sequence:CCGGCGGTCAGTAGTAGACCAACTACTCGAGTAGTTGGTCTACTACTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001176.1-147s1c1
Sequence:CCGGCTACAATTCTGGACGATGCAACTCGAGTTGCATCGTCCAGAATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001176.1-707s1c1
Sequence:CCGGCCACTGAAGAGGAAGCATGATCTCGAGATCATGCTTCCTCTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001176.1-164s1c1
Sequence:CCGGGCAAAGATTTATTCGAGTCATCTCGAGATGACTCGAATAAATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001176
TAF9B MISSION shRNA Lentiviral Transduction Particles
TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001176.1-1538s1c1
Sequence:CCGGCCACTAAAGAACTTTGTTGTTCTCGAGAACAACAAAGTTCTTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001176.1-447s1c1
Sequence:CCGGCGGTCAGTAGTAGACCAACTACTCGAGTAGTTGGTCTACTACTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001176.1-147s1c1
Sequence:CCGGCTACAATTCTGGACGATGCAACTCGAGTTGCATCGTCCAGAATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001176.1-707s1c1
Sequence:CCGGCCACTGAAGAGGAAGCATGATCTCGAGATCATGCTTCCTCTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001176.1-164s1c1
Sequence:CCGGGCAAAGATTTATTCGAGTCATCTCGAGATGACTCGAATAAATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks