EMAIL THIS PAGE TO A FRIEND

TAGAP

T-cell activation RhoGTPase activating protein

Synonyms: ARHGAP47 IDDM21 TAGAP1
UniProtKB ID: Q8N103, Q2NKM8, Q8NI40, Q96KZ2, Q96QA2
Gene ID:
Human(117289) Summary: This gene encodes a member of the Rho GTPase-activator protein superfamily. The encoded protein may function as a Rho GTPase-activating protein. Alterations in this gene may be associated with several diseases, including rheumatoid arthritis, celiac disease, and multiple sclerosis. Alternate splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
Mouse(72536) T cell activation Rho GTPase activating protein
Rat(308097) T-cell activation RhoGTPase activating protein
chicken(421662) T-cell activation RhoGTPase activating protein
domestic cat(101092765) T-cell activation RhoGTPase activating protein
Horse(100050919) T-cell activation RhoGTPase activating protein
dog(484059) T-cell activation RhoGTPase activating protein
cow(509236) T-cell activation RhoGTPase activating protein
sheep(101109975) T-cell activation RhoGTPase activating protein
cow(784926) T-cell activation Rho GTPase-activating protein-like
naked mole-rat(101719403) T-cell activation RhoGTPase activating protein
Domestic Rabbit(100356304) T-cell activation RhoGTPase activating protein
domestic guinea pig(100719220) T-cell activation RhoGTPase activating protein
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054114 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089231 MISSION® esiRNA esiRNA human TAGAP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054114 Rosetta Predictions human pricing
NM_138810 Rosetta Predictions human pricing
NM_152133 Rosetta Predictions human pricing
NM_001107455 Rosetta Predictions rat pricing
NM_145968 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059536 predicted 2505
2 SASI_Hs01_00059537 predicted 903
3 SASI_Hs01_00059538 predicted 2493
4 SASI_Hs01_00059539 predicted 895
5 SASI_Hs02_00361997 predicted 1226
6 SASI_Hs01_00059540 predicted 1178
7 SASI_Hs01_00059541 predicted 1042
8 SASI_Hs01_00059542 predicted 1121
9 SASI_Hs01_00059543 predicted 1793
10 SASI_Hs01_00059544 predicted 911
11 SASI_Hs01_00059545 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101436 predicted 638
2 SASI_Hs01_00101437 predicted 452
3 SASI_Hs01_00101438 predicted 402
4 SASI_Hs02_00363970 predicted 371
5 SASI_Hs02_00363971 predicted 457
6 SASI_Hs02_00363972 predicted 454
7 SASI_Hs02_00363973 predicted 432
8 SASI_Hs01_00101440 predicted 650
9 SASI_Hs01_00101442 predicted 838
10 SASI_Hs01_00101443 predicted 366
11 SASI_Hs01_00101435 predicted 469
12 SASI_Hs01_00101439 predicted 378
13 SASI_Hs01_00101441 predicted 572
14 SASI_Hs01_00101444 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213968 predicted 2335
2 SASI_Hs01_00213969 predicted 735
3 SASI_Hs01_00213970 predicted 2327
4 SASI_Hs01_00213971 predicted 725
5 SASI_Hs02_00365699 predicted 1059
6 SASI_Hs01_00213972 predicted 1008
7 SASI_Hs01_00213973 predicted 878
8 SASI_Hs01_00213974 predicted 952
9 SASI_Hs01_00213975 predicted 1629
10 SASI_Hs01_00213976 predicted 741
11 SASI_Hs01_00213977 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228995 predicted 722
2 SASI_Rn02_00228996 predicted 856
3 SASI_Rn02_00228997 predicted 440
4 SASI_Rn02_00228998 predicted 286
5 SASI_Rn02_00228999 predicted 805
6 SASI_Rn02_00229000 predicted 394
7 SASI_Rn02_00229001 predicted 933
8 SASI_Rn02_00229002 predicted 961
9 SASI_Rn02_00229003 predicted 772
10 SASI_Rn02_00229004 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051757 predicted 1711
2 SASI_Mm01_00051759 predicted 1187
3 SASI_Mm01_00051760 predicted 1641
4 SASI_Mm01_00051761 predicted 919
5 SASI_Mm01_00051762 predicted 1982
6 SASI_Mm01_00051763 predicted 1921
7 SASI_Mm01_00051764 predicted 2278
8 SASI_Mm01_00051765 predicted 795
9 SASI_Mm01_00051766 predicted 2332
10 SASI_Mm02_00341455 predicted 1705
11 SASI_Mm01_00051758 predicted 1934
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054114
TAGAP MISSION shRNA Bacterial Glycerol Stock
T-cell activation RhoGTPase activating protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054114.3-402s21c1
Sequence:CCGGTGTCAATCAGAGGGTGATATCCTCGAGGATATCACCCTCTGATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054114.3-570s21c1
Sequence:CCGGGACTTGAAAGCATCGCTATTTCTCGAGAAATAGCGATGCTTTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-375s1c1
Sequence:CCGGGCCAATAATATGGAGACACTACTCGAGTAGTGTCTCCATATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-1850s1c1
Sequence:CCGGGCACTCCATGTCTTTCACCTTCTCGAGAAGGTGAAAGACATGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-794s1c1
Sequence:CCGGCGCTGTGGTCTTTAAGGACTTCTCGAGAAGTCCTTAAAGACCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-2496s1c1
Sequence:CCGGCAATTCCAATATGCCAAAGAACTCGAGTTCTTTGGCATATTGGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-836s1c1
Sequence:CCGGGCTACTTTCAAGCGACCTCTTCTCGAGAAGAGGTCGCTTGAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054114
TAGAP MISSION shRNA shRNA Plasmid DNA
T-cell activation RhoGTPase activating protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054114.3-402s21c1
Sequence:CCGGTGTCAATCAGAGGGTGATATCCTCGAGGATATCACCCTCTGATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054114.3-570s21c1
Sequence:CCGGGACTTGAAAGCATCGCTATTTCTCGAGAAATAGCGATGCTTTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-375s1c1
Sequence:CCGGGCCAATAATATGGAGACACTACTCGAGTAGTGTCTCCATATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-1850s1c1
Sequence:CCGGGCACTCCATGTCTTTCACCTTCTCGAGAAGGTGAAAGACATGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-794s1c1
Sequence:CCGGCGCTGTGGTCTTTAAGGACTTCTCGAGAAGTCCTTAAAGACCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-2496s1c1
Sequence:CCGGCAATTCCAATATGCCAAAGAACTCGAGTTCTTTGGCATATTGGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-836s1c1
Sequence:CCGGGCTACTTTCAAGCGACCTCTTCTCGAGAAGAGGTCGCTTGAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054114
TAGAP MISSION shRNA Lentiviral Transduction Particles
T-cell activation RhoGTPase activating protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054114.3-402s21c1
Sequence:CCGGTGTCAATCAGAGGGTGATATCCTCGAGGATATCACCCTCTGATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054114.3-570s21c1
Sequence:CCGGGACTTGAAAGCATCGCTATTTCTCGAGAAATAGCGATGCTTTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-375s1c1
Sequence:CCGGGCCAATAATATGGAGACACTACTCGAGTAGTGTCTCCATATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-1850s1c1
Sequence:CCGGGCACTCCATGTCTTTCACCTTCTCGAGAAGGTGAAAGACATGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-794s1c1
Sequence:CCGGCGCTGTGGTCTTTAAGGACTTCTCGAGAAGTCCTTAAAGACCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-2496s1c1
Sequence:CCGGCAATTCCAATATGCCAAAGAACTCGAGTTCTTTGGCATATTGGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054114.3-836s1c1
Sequence:CCGGGCTACTTTCAAGCGACCTCTTCTCGAGAAGAGGTCGCTTGAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145968
TAGAP MISSION shRNA Bacterial Glycerol Stock
T-cell activation RhoGTPase activating protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145968.1-2621s1c1
Sequence:CCGGGCCATGCCTGTGTTCACATTACTCGAGTAATGTGAACACAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145968.1-186s1c1
Sequence:CCGGGCTAACAACATGGAGACATTACTCGAGTAATGTCTCCATGTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145968.1-857s1c1
Sequence:CCGGGCCTAACATGCTCACTCTGAACTCGAGTTCAGAGTGAGCATGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145968.1-383s1c1
Sequence:CCGGGCTGAAAGTGTCGCTGTTTGACTCGAGTCAAACAGCGACACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145968.1-381s1c1
Sequence:CCGGGAGCTGAAAGTGTCGCTGTTTCTCGAGAAACAGCGACACTTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145968
TAGAP MISSION shRNA shRNA Plasmid DNA
T-cell activation RhoGTPase activating protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145968.1-2621s1c1
Sequence:CCGGGCCATGCCTGTGTTCACATTACTCGAGTAATGTGAACACAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145968.1-186s1c1
Sequence:CCGGGCTAACAACATGGAGACATTACTCGAGTAATGTCTCCATGTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145968.1-857s1c1
Sequence:CCGGGCCTAACATGCTCACTCTGAACTCGAGTTCAGAGTGAGCATGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145968.1-383s1c1
Sequence:CCGGGCTGAAAGTGTCGCTGTTTGACTCGAGTCAAACAGCGACACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145968.1-381s1c1
Sequence:CCGGGAGCTGAAAGTGTCGCTGTTTCTCGAGAAACAGCGACACTTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145968
TAGAP MISSION shRNA Lentiviral Transduction Particles
T-cell activation RhoGTPase activating protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145968.1-2621s1c1
Sequence:CCGGGCCATGCCTGTGTTCACATTACTCGAGTAATGTGAACACAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145968.1-186s1c1
Sequence:CCGGGCTAACAACATGGAGACATTACTCGAGTAATGTCTCCATGTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145968.1-857s1c1
Sequence:CCGGGCCTAACATGCTCACTCTGAACTCGAGTTCAGAGTGAGCATGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145968.1-383s1c1
Sequence:CCGGGCTGAAAGTGTCGCTGTTTGACTCGAGTCAAACAGCGACACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145968.1-381s1c1
Sequence:CCGGGAGCTGAAAGTGTCGCTGTTTCTCGAGAAACAGCGACACTTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks