EMAIL THIS PAGE TO A FRIEND

TAGLN2

transgelin 2

Synonyms: HA1756
Gene ID:
Human(8407) Summary: The protein encoded by this gene is similar to the protein transgelin, which is one of the earliest markers of differentiated smooth muscle. The specific function of this protein has not yet been determined, although it is thought to be a tumor suppressor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
Mouse(21346) transgelin 2
Rat(304983) transgelin 2
cow(282379) transgelin 2
sheep(101116785) transgelin 2
Zebrafish(259183) transgelin 2
dog(610210) transgelin 2
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003564 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178598 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178598 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178598 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003564 Rosetta Predictions human pricing
NM_001013127 Rosetta Predictions rat pricing
NM_178598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335861 predicted 508
2 SASI_Hs02_00335862 predicted 382
3 SASI_Hs02_00335863 predicted 885
4 SASI_Hs02_00335864 predicted 506
5 SASI_Hs02_00335865 predicted 987
6 SASI_Hs01_00203246 predicted 694
7 SASI_Hs02_00335866 predicted 533
8 SASI_Hs02_00335867 predicted 924
9 SASI_Hs02_00335868 predicted 542
10 SASI_Hs01_00203248 predicted 254
11 SASI_Hs01_00203244 predicted 259
12 SASI_Hs01_00203245 predicted 656
13 SASI_Hs01_00203247 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063861 predicted 238
2 SASI_Rn01_00063862 predicted 359
3 SASI_Rn01_00063863 predicted 414
4 SASI_Rn01_00063864 predicted 356
5 SASI_Rn01_00063865 predicted 383
6 SASI_Rn02_00200836 predicted 229
7 SASI_Rn01_00063866 predicted 424
8 SASI_Rn01_00063867 predicted 243
9 SASI_Rn01_00063868 predicted 347
10 SASI_Rn01_00063869 predicted 290
11 SASI_Rn01_00063870 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025568 predicted 473
2 SASI_Mm02_00348922 predicted 443
3 SASI_Mm02_00348923 predicted 485
4 SASI_Mm02_00348924 predicted 216
5 SASI_Mm01_00025575 predicted 477
6 SASI_Mm02_00348925 predicted 306
7 SASI_Mm01_00025577 predicted 293
8 SASI_Mm02_00348926 predicted 1148
9 SASI_Mm02_00348927 predicted 1143
10 SASI_Mm02_00348928 predicted 353
11 SASI_Mm01_00025569 predicted 412
12 SASI_Mm01_00025570 predicted 277
13 SASI_Mm01_00025571 predicted 402
14 SASI_Mm01_00025572 predicted 281
15 SASI_Mm01_00025573 predicted 279
16 SASI_Mm01_00025574 predicted 278
17 SASI_Mm01_00025576 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003564
VALIDATED
TAGLN2 MISSION shRNA Bacterial Glycerol Stock
transgelin 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003564.1-538s1c1
Sequence:CCGGCAAGGAGAATCCTCGGAACTTCTCGAGAAGTTCCGAGGATTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003564.1-586s1c1
Sequence:CCGGGAACGTGATCGGGTTACAGATCTCGAGATCTGTAACCCGATCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003564.1-252s1c1
Sequence:CCGGCGGTGCTATGTGAGCTCATTACTCGAGTAATGAGCTCACATAGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003564.1-515s1c1
Sequence:CCGGCCCAACTGGTTCCCTAAGAAACTCGAGTTTCTTAGGGAACCAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003564.1-960s1c1
Sequence:CCGGCCTATTCTGTCTCTCCTTCTTCTCGAGAAGAAGGAGAGACAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003564.1-377s1c1
Sequence:CCGGCGCTATGGCATTAACACCACTCTCGAGAGTGGTGTTAATGCCATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003564.1-538s21c1
Sequence:CCGGCAAGGAGAATCCTCGGAACTTCTCGAGAAGTTCCGAGGATTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003564.1-960s21c1
Sequence:CCGGCCTATTCTGTCTCTCCTTCTTCTCGAGAAGAAGGAGAGACAGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003564.1-586s21c1
Sequence:CCGGGAACGTGATCGGGTTACAGATCTCGAGATCTGTAACCCGATCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003564.1-252s21c1
Sequence:CCGGCGGTGCTATGTGAGCTCATTACTCGAGTAATGAGCTCACATAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003564.1-377s21c1
Sequence:CCGGCGCTATGGCATTAACACCACTCTCGAGAGTGGTGTTAATGCCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003564
VALIDATED
TAGLN2 MISSION shRNA shRNA Plasmid DNA
transgelin 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003564.1-538s1c1
Sequence:CCGGCAAGGAGAATCCTCGGAACTTCTCGAGAAGTTCCGAGGATTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003564.1-586s1c1
Sequence:CCGGGAACGTGATCGGGTTACAGATCTCGAGATCTGTAACCCGATCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003564.1-252s1c1
Sequence:CCGGCGGTGCTATGTGAGCTCATTACTCGAGTAATGAGCTCACATAGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003564.1-515s1c1
Sequence:CCGGCCCAACTGGTTCCCTAAGAAACTCGAGTTTCTTAGGGAACCAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003564.1-960s1c1
Sequence:CCGGCCTATTCTGTCTCTCCTTCTTCTCGAGAAGAAGGAGAGACAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003564.1-377s1c1
Sequence:CCGGCGCTATGGCATTAACACCACTCTCGAGAGTGGTGTTAATGCCATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003564.1-538s21c1
Sequence:CCGGCAAGGAGAATCCTCGGAACTTCTCGAGAAGTTCCGAGGATTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003564.1-960s21c1
Sequence:CCGGCCTATTCTGTCTCTCCTTCTTCTCGAGAAGAAGGAGAGACAGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003564.1-586s21c1
Sequence:CCGGGAACGTGATCGGGTTACAGATCTCGAGATCTGTAACCCGATCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003564.1-252s21c1
Sequence:CCGGCGGTGCTATGTGAGCTCATTACTCGAGTAATGAGCTCACATAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003564.1-377s21c1
Sequence:CCGGCGCTATGGCATTAACACCACTCTCGAGAGTGGTGTTAATGCCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003564
VALIDATED
TAGLN2 MISSION shRNA Lentiviral Transduction Particles
transgelin 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003564.1-538s1c1
Sequence:CCGGCAAGGAGAATCCTCGGAACTTCTCGAGAAGTTCCGAGGATTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003564.1-586s1c1
Sequence:CCGGGAACGTGATCGGGTTACAGATCTCGAGATCTGTAACCCGATCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003564.1-252s1c1
Sequence:CCGGCGGTGCTATGTGAGCTCATTACTCGAGTAATGAGCTCACATAGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003564.1-515s1c1
Sequence:CCGGCCCAACTGGTTCCCTAAGAAACTCGAGTTTCTTAGGGAACCAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003564.1-960s1c1
Sequence:CCGGCCTATTCTGTCTCTCCTTCTTCTCGAGAAGAAGGAGAGACAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003564.1-377s1c1
Sequence:CCGGCGCTATGGCATTAACACCACTCTCGAGAGTGGTGTTAATGCCATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003564.1-538s21c1
Sequence:CCGGCAAGGAGAATCCTCGGAACTTCTCGAGAAGTTCCGAGGATTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003564.1-960s21c1
Sequence:CCGGCCTATTCTGTCTCTCCTTCTTCTCGAGAAGAAGGAGAGACAGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003564.1-586s21c1
Sequence:CCGGGAACGTGATCGGGTTACAGATCTCGAGATCTGTAACCCGATCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003564.1-252s21c1
Sequence:CCGGCGGTGCTATGTGAGCTCATTACTCGAGTAATGAGCTCACATAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003564.1-377s21c1
Sequence:CCGGCGCTATGGCATTAACACCACTCTCGAGAGTGGTGTTAATGCCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178598
VALIDATED
TAGLN2 MISSION shRNA Bacterial Glycerol Stock
transgelin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178598.1-721s1c1
Sequence:CCGGCCCTCCATGAATGGTTAATATCTCGAGATATTAACCATTCATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178598.1-610s1c1
Sequence:CCGGGAACGTGATTGGGTTGCAGATCTCGAGATCTGCAACCCAATCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178598.1-540s1c1
Sequence:CCGGCCAACTGGTTTCCTAAGAAATCTCGAGATTTCTTAGGAAACCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178598.1-406s1c1
Sequence:CCGGTGGCATTAACACCACGGACATCTCGAGATGTCCGTGGTGTTAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178598.1-571s1c1
Sequence:CCGGCCCTCGGAACTTCTCGGACAACTCGAGTTGTCCGAGAAGTTCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178598.2-589s21c1
Sequence:CCGGCCCTCGGAACTTCTCGGACAACTCGAGTTGTCCGAGAAGTTCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178598.2-424s21c1
Sequence:CCGGTGGCATTAACACCACGGACATCTCGAGATGTCCGTGGTGTTAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178598.2-628s21c1
Sequence:CCGGGAACGTGATTGGGTTGCAGATCTCGAGATCTGCAACCCAATCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178598.2-558s21c1
Sequence:CCGGCCAACTGGTTTCCTAAGAAATCTCGAGATTTCTTAGGAAACCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178598.2-739s21c1
Sequence:CCGGCCCTCCATGAATGGTTAATATCTCGAGATATTAACCATTCATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178598
VALIDATED
TAGLN2 MISSION shRNA shRNA Plasmid DNA
transgelin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178598.1-721s1c1
Sequence:CCGGCCCTCCATGAATGGTTAATATCTCGAGATATTAACCATTCATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178598.1-610s1c1
Sequence:CCGGGAACGTGATTGGGTTGCAGATCTCGAGATCTGCAACCCAATCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178598.1-540s1c1
Sequence:CCGGCCAACTGGTTTCCTAAGAAATCTCGAGATTTCTTAGGAAACCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178598.1-406s1c1
Sequence:CCGGTGGCATTAACACCACGGACATCTCGAGATGTCCGTGGTGTTAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178598.1-571s1c1
Sequence:CCGGCCCTCGGAACTTCTCGGACAACTCGAGTTGTCCGAGAAGTTCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178598.2-589s21c1
Sequence:CCGGCCCTCGGAACTTCTCGGACAACTCGAGTTGTCCGAGAAGTTCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178598.2-424s21c1
Sequence:CCGGTGGCATTAACACCACGGACATCTCGAGATGTCCGTGGTGTTAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178598.2-628s21c1
Sequence:CCGGGAACGTGATTGGGTTGCAGATCTCGAGATCTGCAACCCAATCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178598.2-558s21c1
Sequence:CCGGCCAACTGGTTTCCTAAGAAATCTCGAGATTTCTTAGGAAACCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178598.2-739s21c1
Sequence:CCGGCCCTCCATGAATGGTTAATATCTCGAGATATTAACCATTCATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178598
VALIDATED
TAGLN2 MISSION shRNA Lentiviral Transduction Particles
transgelin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178598.1-721s1c1
Sequence:CCGGCCCTCCATGAATGGTTAATATCTCGAGATATTAACCATTCATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178598.1-610s1c1
Sequence:CCGGGAACGTGATTGGGTTGCAGATCTCGAGATCTGCAACCCAATCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178598.1-540s1c1
Sequence:CCGGCCAACTGGTTTCCTAAGAAATCTCGAGATTTCTTAGGAAACCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178598.1-406s1c1
Sequence:CCGGTGGCATTAACACCACGGACATCTCGAGATGTCCGTGGTGTTAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178598.1-571s1c1
Sequence:CCGGCCCTCGGAACTTCTCGGACAACTCGAGTTGTCCGAGAAGTTCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178598.2-589s21c1
Sequence:CCGGCCCTCGGAACTTCTCGGACAACTCGAGTTGTCCGAGAAGTTCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178598.2-424s21c1
Sequence:CCGGTGGCATTAACACCACGGACATCTCGAGATGTCCGTGGTGTTAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178598.2-628s21c1
Sequence:CCGGGAACGTGATTGGGTTGCAGATCTCGAGATCTGCAACCCAATCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178598.2-558s21c1
Sequence:CCGGCCAACTGGTTTCCTAAGAAATCTCGAGATTTCTTAGGAAACCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178598.2-739s21c1
Sequence:CCGGCCCTCCATGAATGGTTAATATCTCGAGATATTAACCATTCATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks