EMAIL THIS PAGE TO A FRIEND

TAGLN3

transgelin 3

Synonyms: NP22 NP24 NP25
UniProtKB ID: Q9UI15, D3DN64, Q96A74
Gene ID:
Mouse(56370) transgelin 3
Rat(63837) transgelin 3
chicken(418420) transgelin 3
dog(478562) transgelin 3
cow(515562) transgelin 3
sheep(101119600) transgelin 3
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013259 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019754 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019754 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019754 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120421 MISSION® esiRNA esiRNA human TAGLN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008272 Rosetta Predictions human pricing
NM_001008273 Rosetta Predictions human pricing
NM_013259 Rosetta Predictions human pricing
NM_001035236 Rosetta Predictions rat pricing
NM_031676 Rosetta Predictions rat pricing
NM_019754 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231450 predicted 765
2 SASI_Hs01_00231451 predicted 590
3 SASI_Hs01_00231452 predicted 681
4 SASI_Hs01_00231453 predicted 601
5 SASI_Hs01_00231454 predicted 878
6 SASI_Hs01_00231455 predicted 932
7 SASI_Hs01_00231456 predicted 596
8 SASI_Hs02_00305412 predicted 642
9 SASI_Hs01_00231457 predicted 1004
10 SASI_Hs01_00231458 predicted 692
11 SASI_Hs01_00231449 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093299 predicted 648
2 SASI_Hs01_00093300 predicted 475
3 SASI_Hs01_00093301 predicted 572
4 SASI_Hs01_00093302 predicted 485
5 SASI_Hs01_00093303 predicted 765
6 SASI_Hs01_00093304 predicted 815
7 SASI_Hs01_00093305 predicted 486
8 SASI_Hs02_00305413 predicted 532
9 SASI_Hs01_00093306 predicted 887
10 SASI_Hs01_00093307 predicted 573
11 SASI_Hs01_00093298 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158884 predicted 938
2 SASI_Hs01_00158885 predicted 769
3 SASI_Hs01_00158886 predicted 863
4 SASI_Hs01_00158887 predicted 783
5 SASI_Hs01_00158888 predicted 1052
6 SASI_Hs01_00158889 predicted 1111
7 SASI_Hs01_00158890 predicted 774
8 SASI_Hs02_00344479 predicted 822
9 SASI_Hs01_00158891 predicted 1175
10 SASI_Hs01_00158892 predicted 860
11 SASI_Hs01_00158883 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089561 predicted 731
2 SASI_Rn01_00089563 predicted 346
3 SASI_Rn01_00089564 predicted 732
4 SASI_Rn01_00089565 predicted 651
5 SASI_Rn02_00204192 predicted 387
6 SASI_Rn01_00089566 predicted 802
7 SASI_Rn01_00089567 predicted 504
8 SASI_Rn01_00089568 predicted 736
9 SASI_Rn01_00089569 predicted 765
10 SASI_Rn01_00089570 predicted 486
11 SASI_Rn01_00089562 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072097 predicted 682
2 SASI_Rn01_00072099 predicted 290
3 SASI_Rn01_00072100 predicted 684
4 SASI_Rn01_00072101 predicted 594
5 SASI_Rn02_00265020 predicted 326
6 SASI_Rn01_00072102 predicted 747
7 SASI_Rn01_00072103 predicted 451
8 SASI_Rn01_00072104 predicted 684
9 SASI_Rn01_00072105 predicted 716
10 SASI_Rn01_00072106 predicted 427
11 SASI_Rn01_00072098 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064028 predicted 529
2 SASI_Mm01_00064029 predicted 405
3 SASI_Mm01_00064030 predicted 278
4 SASI_Mm01_00064031 predicted 240
5 SASI_Mm01_00064032 predicted 812
6 SASI_Mm01_00064034 predicted 621
7 SASI_Mm01_00064036 predicted 328
8 SASI_Mm01_00064037 predicted 714
9 SASI_Mm02_00324919 predicted 665
10 SASI_Mm02_00324920 predicted 577
11 SASI_Mm01_00064033 predicted 468
12 SASI_Mm01_00064035 predicted 412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013259
TAGLN3 MISSION shRNA Bacterial Glycerol Stock
transgelin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013259.2-1131s21c1
Sequence:CCGGGATGCCCAGGCAGATCATGTACTCGAGTACATGATCTGCCTGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013259.2-1053s21c1
Sequence:CCGGTCGCCAGGGACAGAACGTAATCTCGAGATTACGTTCTGTCCCTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013259.2-739s21c1
Sequence:CCGGTGCAAGCTGATAAATAGTTTACTCGAGTAAACTATTTATCAGCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-95s1c1
Sequence:CCGGGAGAAGATCGAGCAGAAGTATCTCGAGATACTTCTGCTCGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-818s1c1
Sequence:CCGGCCACCTCCTGTTCATTTAGAACTCGAGTTCTAAATGAACAGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-289s1c1
Sequence:CCGGCTCAGAGTCAAAGATGGCTTTCTCGAGAAAGCCATCTTTGACTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-452s1c1
Sequence:CCGGGTTGCAGTCACCAAGGATGATCTCGAGATCATCCTTGGTGACTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-320s1c1
Sequence:CCGGGAGCAAATCTCCCAGTTCCTACTCGAGTAGGAACTGGGAGATTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013259
TAGLN3 MISSION shRNA shRNA Plasmid DNA
transgelin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013259.2-1131s21c1
Sequence:CCGGGATGCCCAGGCAGATCATGTACTCGAGTACATGATCTGCCTGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013259.2-1053s21c1
Sequence:CCGGTCGCCAGGGACAGAACGTAATCTCGAGATTACGTTCTGTCCCTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013259.2-739s21c1
Sequence:CCGGTGCAAGCTGATAAATAGTTTACTCGAGTAAACTATTTATCAGCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-95s1c1
Sequence:CCGGGAGAAGATCGAGCAGAAGTATCTCGAGATACTTCTGCTCGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-818s1c1
Sequence:CCGGCCACCTCCTGTTCATTTAGAACTCGAGTTCTAAATGAACAGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-289s1c1
Sequence:CCGGCTCAGAGTCAAAGATGGCTTTCTCGAGAAAGCCATCTTTGACTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-452s1c1
Sequence:CCGGGTTGCAGTCACCAAGGATGATCTCGAGATCATCCTTGGTGACTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-320s1c1
Sequence:CCGGGAGCAAATCTCCCAGTTCCTACTCGAGTAGGAACTGGGAGATTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013259
TAGLN3 MISSION shRNA Lentiviral Transduction Particles
transgelin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013259.2-1131s21c1
Sequence:CCGGGATGCCCAGGCAGATCATGTACTCGAGTACATGATCTGCCTGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013259.2-1053s21c1
Sequence:CCGGTCGCCAGGGACAGAACGTAATCTCGAGATTACGTTCTGTCCCTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013259.2-739s21c1
Sequence:CCGGTGCAAGCTGATAAATAGTTTACTCGAGTAAACTATTTATCAGCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-95s1c1
Sequence:CCGGGAGAAGATCGAGCAGAAGTATCTCGAGATACTTCTGCTCGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-818s1c1
Sequence:CCGGCCACCTCCTGTTCATTTAGAACTCGAGTTCTAAATGAACAGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-289s1c1
Sequence:CCGGCTCAGAGTCAAAGATGGCTTTCTCGAGAAAGCCATCTTTGACTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-452s1c1
Sequence:CCGGGTTGCAGTCACCAAGGATGATCTCGAGATCATCCTTGGTGACTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013259.1-320s1c1
Sequence:CCGGGAGCAAATCTCCCAGTTCCTACTCGAGTAGGAACTGGGAGATTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019754
TAGLN3 MISSION shRNA Bacterial Glycerol Stock
transgelin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019754.3-947s21c1
Sequence:CCGGTCCTTGCAAGTGCTGCATTTCCTCGAGGAAATGCAGCACTTGCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019754.3-880s1c1
Sequence:CCGGCCCGTGACAAAGAAATAGGTACTCGAGTACCTATTTCTTTGTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019754.3-413s1c1
Sequence:CCGGGCAAGCTGATAAACAGTTTATCTCGAGATAAACTGTTTATCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019754.3-667s1c1
Sequence:CCGGCCATCCTGGTTTCACAGGAAACTCGAGTTTCCTGTGAAACCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019754.3-689s1c1
Sequence:CCGGCCCAGCAGAATCGGAGAGGATCTCGAGATCCTCTCCGATTCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019754
TAGLN3 MISSION shRNA shRNA Plasmid DNA
transgelin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019754.3-947s21c1
Sequence:CCGGTCCTTGCAAGTGCTGCATTTCCTCGAGGAAATGCAGCACTTGCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019754.3-880s1c1
Sequence:CCGGCCCGTGACAAAGAAATAGGTACTCGAGTACCTATTTCTTTGTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019754.3-413s1c1
Sequence:CCGGGCAAGCTGATAAACAGTTTATCTCGAGATAAACTGTTTATCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019754.3-667s1c1
Sequence:CCGGCCATCCTGGTTTCACAGGAAACTCGAGTTTCCTGTGAAACCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019754.3-689s1c1
Sequence:CCGGCCCAGCAGAATCGGAGAGGATCTCGAGATCCTCTCCGATTCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019754
TAGLN3 MISSION shRNA Lentiviral Transduction Particles
transgelin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019754.3-947s21c1
Sequence:CCGGTCCTTGCAAGTGCTGCATTTCCTCGAGGAAATGCAGCACTTGCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019754.3-880s1c1
Sequence:CCGGCCCGTGACAAAGAAATAGGTACTCGAGTACCTATTTCTTTGTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019754.3-413s1c1
Sequence:CCGGGCAAGCTGATAAACAGTTTATCTCGAGATAAACTGTTTATCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019754.3-667s1c1
Sequence:CCGGCCATCCTGGTTTCACAGGAAACTCGAGTTTCCTGTGAAACCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019754.3-689s1c1
Sequence:CCGGCCCAGCAGAATCGGAGAGGATCTCGAGATCCTCTCCGATTCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks