EMAIL THIS PAGE TO A FRIEND

TAGLN

transgelin

Synonyms: SM22 SMCC TAGLN1 WS3-10
UniProtKB ID: Q01995, O15542
Gene ID:
Human(6876) Summary: The protein encoded by this gene is a transformation and shape-change sensitive actin cross-linking/gelling protein found in fibroblasts and smooth muscle. Its expression is down-regulated in many cell lines, and this down-regulation may be an early and sensitive marker for the onset of transformation. A functional role of this protein is unclear. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(21345) transgelin
Rat(25123) transgelin
Zebrafish(751758) transgelin
Horse(100062690) transgelin
dog(479424) transgelin
chicken(396490) transgelin
cow(513463) transgelin
sheep(101118555) transgelin
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003186 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022151 MISSION® esiRNA esiRNA human TAGLN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001522 Rosetta Predictions human pricing
NM_003186 Rosetta Predictions human pricing
NM_031549 Rosetta Predictions rat pricing
XM_579512 Rosetta Predictions rat pricing
NM_011526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303806 predicted 1027
2 SASI_Hs01_00242510 predicted 1241
3 SASI_Hs01_00242511 predicted 1225
4 SASI_Hs02_00303807 predicted 728
5 SASI_Hs02_00303808 predicted 922
6 SASI_Hs02_00303809 predicted 1176
7 SASI_Hs02_00303810 predicted 1029
8 SASI_Hs02_00303811 predicted 1110
9 SASI_Hs01_00242508 predicted 1299
10 SASI_Hs02_00303812 predicted 954
11 SASI_Hs01_00242509 predicted 1300
12 SASI_Hs01_00242512 predicted 1195
13 SASI_Hs01_00242513 predicted 1161
14 SASI_Hs01_00242514 predicted 1197
15 SASI_Hs01_00242515 predicted 1205
16 SASI_Hs01_00242516 predicted 1236
17 SASI_Hs01_00242517 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014396 predicted 839
2 SASI_Hs02_00335216 predicted 833
3 SASI_Hs02_00335217 predicted 793
4 SASI_Hs02_00335218 predicted 760
5 SASI_Hs02_00335219 predicted 791
6 SASI_Hs02_00335220 predicted 803
7 SASI_Hs02_00335221 predicted 795
8 SASI_Hs02_00335222 predicted 832
9 SASI_Hs02_00335223 predicted 814
10 SASI_Hs02_00335224 predicted 812
11 SASI_Hs01_00014393 predicted 634
12 SASI_Hs01_00014394 predicted 907
13 SASI_Hs01_00014395 predicted 568
14 SASI_Hs01_00014397 predicted 554
15 SASI_Hs01_00014398 predicted 434
16 SASI_Hs01_00014399 predicted 590
17 SASI_Hs01_00014400 predicted 570
18 SASI_Hs01_00014401 predicted 331
19 SASI_Hs01_00014402 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060075 predicted 532
2 SASI_Rn01_00060077 predicted 564
3 SASI_Rn02_00264734 predicted 570
4 SASI_Rn01_00060078 predicted 392
5 SASI_Rn01_00060079 predicted 212
6 SASI_Rn01_00060080 predicted 467
7 SASI_Rn01_00060081 predicted 364
8 SASI_Rn01_00060083 predicted 232
9 SASI_Rn02_00264735 predicted 489
10 SASI_Rn02_00264736 predicted 485
11 SASI_Rn01_00060076 predicted 245
12 SASI_Rn01_00060082 predicted 479
13 SASI_Rn01_00060084 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171578 predicted 502
2 SASI_Rn01_00171579 predicted 232
3 SASI_Rn01_00171580 predicted 224
4 SASI_Rn01_00171581 predicted 482
5 SASI_Rn01_00171582 predicted 379
6 SASI_Rn01_00171583 predicted 248
7 SASI_Rn01_00171584 predicted 422
8 SASI_Rn01_00171585 predicted 385
9 SASI_Rn01_00171586 predicted 434
10 SASI_Rn01_00171587 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135382 predicted 239
2 SASI_Mm01_00135383 predicted 385
3 SASI_Mm01_00135384 predicted 595
4 SASI_Mm01_00135385 predicted 419
5 SASI_Mm01_00135386 predicted 499
6 SASI_Mm01_00135387 predicted 593
7 SASI_Mm02_00320846 predicted 707
8 SASI_Mm01_00135388 predicted 432
9 SASI_Mm01_00135389 predicted 346
10 SASI_Mm01_00135390 predicted 506
11 SASI_Mm01_00135391 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011526
VALIDATED
TAGLN MISSION shRNA Bacterial Glycerol Stock
transgelin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011526.4-716s21c1
Sequence:CCGGTGCTTAGCCTGCCTCACAAATCTCGAGATTTGTGAGGCAGGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011526.4-593s21c1
Sequence:CCGGGCACGTCATTGGCCTTCAAATCTCGAGATTTGAAGGCCAATGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011526.4-242s21c1
Sequence:CCGGGCTGAAGAATGGTGTGATTCTCTCGAGAGAATCACACCATTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011526.4-162s21c1
Sequence:CCGGCGACTAGTGGAGTGGATTGTACTCGAGTACAATCCACTCCACTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011526.2-594s1c1
Sequence:CCGGGCACGTCATTGGCCTTCAAATCTCGAGATTTGAAGGCCAATGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011526.2-163s1c1
Sequence:CCGGCGACTAGTGGAGTGGATTGTACTCGAGTACAATCCACTCCACTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011526.2-243s1c1
Sequence:CCGGGCTGAAGAATGGTGTGATTCTCTCGAGAGAATCACACCATTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011526
VALIDATED
TAGLN MISSION shRNA shRNA Plasmid DNA
transgelin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011526.4-716s21c1
Sequence:CCGGTGCTTAGCCTGCCTCACAAATCTCGAGATTTGTGAGGCAGGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011526.4-593s21c1
Sequence:CCGGGCACGTCATTGGCCTTCAAATCTCGAGATTTGAAGGCCAATGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011526.4-242s21c1
Sequence:CCGGGCTGAAGAATGGTGTGATTCTCTCGAGAGAATCACACCATTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011526.4-162s21c1
Sequence:CCGGCGACTAGTGGAGTGGATTGTACTCGAGTACAATCCACTCCACTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011526.2-594s1c1
Sequence:CCGGGCACGTCATTGGCCTTCAAATCTCGAGATTTGAAGGCCAATGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011526.2-163s1c1
Sequence:CCGGCGACTAGTGGAGTGGATTGTACTCGAGTACAATCCACTCCACTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011526.2-243s1c1
Sequence:CCGGGCTGAAGAATGGTGTGATTCTCTCGAGAGAATCACACCATTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011526
VALIDATED
TAGLN MISSION shRNA Lentiviral Transduction Particles
transgelin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011526.4-716s21c1
Sequence:CCGGTGCTTAGCCTGCCTCACAAATCTCGAGATTTGTGAGGCAGGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011526.4-593s21c1
Sequence:CCGGGCACGTCATTGGCCTTCAAATCTCGAGATTTGAAGGCCAATGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011526.4-242s21c1
Sequence:CCGGGCTGAAGAATGGTGTGATTCTCTCGAGAGAATCACACCATTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011526.4-162s21c1
Sequence:CCGGCGACTAGTGGAGTGGATTGTACTCGAGTACAATCCACTCCACTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011526.2-594s1c1
Sequence:CCGGGCACGTCATTGGCCTTCAAATCTCGAGATTTGAAGGCCAATGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011526.2-163s1c1
Sequence:CCGGCGACTAGTGGAGTGGATTGTACTCGAGTACAATCCACTCCACTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011526.2-243s1c1
Sequence:CCGGGCTGAAGAATGGTGTGATTCTCTCGAGAGAATCACACCATTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003186
VALIDATED
TAGLN MISSION shRNA Bacterial Glycerol Stock
transgelin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003186.3-907s21c1
Sequence:CCGGCCAACTTCTTACCCGAAAGCACTCGAGTGCTTTCGGGTAAGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003186.3-637s21c1
Sequence:CCGGGCATGTCATTGGCCTTCAGATCTCGAGATCTGAAGGCCAATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003186.3-458s21c1
Sequence:CCGGCAGACTGTTGACCTCTTTGAACTCGAGTTCAAAGAGGTCAACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003186.3-707s21c1
Sequence:CCGGCCTCGGCAGATCATCAGTTAGCTCGAGCTAACTGATGATCTGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003186.3-907s1c1
Sequence:CCGGCCAACTTCTTACCCGAAAGCACTCGAGTGCTTTCGGGTAAGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003186.3-458s1c1
Sequence:CCGGCAGACTGTTGACCTCTTTGAACTCGAGTTCAAAGAGGTCAACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003186.3-215s1c1
Sequence:CCGGGAGTGGATCATAGTGCAGTGTCTCGAGACACTGCACTATGATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003186.3-637s1c1
Sequence:CCGGGCATGTCATTGGCCTTCAGATCTCGAGATCTGAAGGCCAATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003186.3-589s1c1
Sequence:CCGGGCAGGAGCATAAGAGGGAATTCTCGAGAATTCCCTCTTATGCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003186
VALIDATED
TAGLN MISSION shRNA shRNA Plasmid DNA
transgelin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003186.3-907s21c1
Sequence:CCGGCCAACTTCTTACCCGAAAGCACTCGAGTGCTTTCGGGTAAGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003186.3-637s21c1
Sequence:CCGGGCATGTCATTGGCCTTCAGATCTCGAGATCTGAAGGCCAATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003186.3-458s21c1
Sequence:CCGGCAGACTGTTGACCTCTTTGAACTCGAGTTCAAAGAGGTCAACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003186.3-707s21c1
Sequence:CCGGCCTCGGCAGATCATCAGTTAGCTCGAGCTAACTGATGATCTGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003186.3-907s1c1
Sequence:CCGGCCAACTTCTTACCCGAAAGCACTCGAGTGCTTTCGGGTAAGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003186.3-458s1c1
Sequence:CCGGCAGACTGTTGACCTCTTTGAACTCGAGTTCAAAGAGGTCAACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003186.3-215s1c1
Sequence:CCGGGAGTGGATCATAGTGCAGTGTCTCGAGACACTGCACTATGATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003186.3-637s1c1
Sequence:CCGGGCATGTCATTGGCCTTCAGATCTCGAGATCTGAAGGCCAATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003186.3-589s1c1
Sequence:CCGGGCAGGAGCATAAGAGGGAATTCTCGAGAATTCCCTCTTATGCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003186
VALIDATED
TAGLN MISSION shRNA Lentiviral Transduction Particles
transgelin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003186.3-907s21c1
Sequence:CCGGCCAACTTCTTACCCGAAAGCACTCGAGTGCTTTCGGGTAAGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003186.3-637s21c1
Sequence:CCGGGCATGTCATTGGCCTTCAGATCTCGAGATCTGAAGGCCAATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003186.3-458s21c1
Sequence:CCGGCAGACTGTTGACCTCTTTGAACTCGAGTTCAAAGAGGTCAACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003186.3-707s21c1
Sequence:CCGGCCTCGGCAGATCATCAGTTAGCTCGAGCTAACTGATGATCTGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003186.3-907s1c1
Sequence:CCGGCCAACTTCTTACCCGAAAGCACTCGAGTGCTTTCGGGTAAGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003186.3-458s1c1
Sequence:CCGGCAGACTGTTGACCTCTTTGAACTCGAGTTCAAAGAGGTCAACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003186.3-215s1c1
Sequence:CCGGGAGTGGATCATAGTGCAGTGTCTCGAGACACTGCACTATGATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003186.3-637s1c1
Sequence:CCGGGCATGTCATTGGCCTTCAGATCTCGAGATCTGAAGGCCAATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003186.3-589s1c1
Sequence:CCGGGCAGGAGCATAAGAGGGAATTCTCGAGAATTCCCTCTTATGCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks