EMAIL THIS PAGE TO A FRIEND

TAL1

T-cell acute lymphocytic leukemia 1

Synonyms: SCL TCL5 bHLHa17 tal-1
UniProtKB ID: P17542, D3DQ24
Gene ID:
Mouse(21349) T cell acute lymphocytic leukemia 1
Rat(313507) T-cell acute lymphocytic leukemia 1
Zebrafish(30766) T-cell acute lymphocytic leukemia 1
chicken(396298) T-cell acute lymphocytic leukemia 1
domestic cat(101097409) T-cell acute lymphocytic leukemia 1
dog(610331) T-cell acute lymphocytic leukemia 1
cow(518657) T-cell acute lymphocytic leukemia 1
sheep(101113901) T-cell acute lymphocytic leukemia 1
naked mole-rat(101704681) T-cell acute lymphocytic leukemia 1
domestic guinea pig(100714614) T-cell acute lymphocytic leukemia 1
218 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011527 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011527 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011527 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003189 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU090691 MISSION® esiRNA esiRNA targeting mouse Tal1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003189 Rosetta Predictions human pricing
NM_001107958 Rosetta Predictions rat pricing
NM_011527 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165746 predicted 1777
2 SASI_Hs01_00165747 predicted 1645
3 SASI_Hs01_00165748 predicted 1659
4 SASI_Hs01_00165749 predicted 1750
5 SASI_Hs01_00165750 predicted 2005
6 SASI_Hs01_00165751 predicted 2050
7 SASI_Hs01_00165752 predicted 1877
8 SASI_Hs01_00165753 predicted 1993
9 SASI_Hs01_00165754 predicted 2003
10 SASI_Hs01_00165755 predicted 1914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233965 predicted 1674
2 SASI_Rn02_00233966 predicted 1385
3 SASI_Rn02_00233967 predicted 1143
4 SASI_Rn02_00233968 predicted 1403
5 SASI_Rn02_00233969 predicted 1566
6 SASI_Rn02_00233970 predicted 1920
7 SASI_Rn02_00233971 predicted 1975
8 SASI_Rn02_00233972 predicted 1185
9 SASI_Rn02_00233973 predicted 1959
10 SASI_Rn02_00233974 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037684 predicted 789
2 SASI_Mm01_00037685 predicted 1209
3 SASI_Mm01_00037687 predicted 828
4 SASI_Mm01_00037688 predicted 1224
5 SASI_Mm01_00037689 predicted 1548
6 SASI_Mm01_00037690 predicted 1318
7 SASI_Mm02_00320847 predicted 1313
8 SASI_Mm01_00037691 predicted 1232
9 SASI_Mm01_00037692 predicted 1419
10 SASI_Mm01_00037693 predicted 696
11 SASI_Mm01_00037686 predicted 1459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011527
TAL1 MISSION shRNA Bacterial Glycerol Stock
T-cell acute lymphocytic leukemia 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-831s1c1
Sequence:CCGGCCTTGCCATGAAGTACATCAACTCGAGTTGATGTACTTCATGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-733s1c1
Sequence:CCGGTGGAGGCAGCAGAATGTGAATCTCGAGATTCACATTCTGCTGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-169s1c1
Sequence:CCGGGCACGCAGTGACCCGCAACTACTCGAGTAGTTGCGGGTCACTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-370s1c1
Sequence:CCGGCGCGACGCAGTAGCAGCCGAACTCGAGTTCGGCTGCTACTGCGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-541s1c1
Sequence:CCGGCGAGCGCTGCTCTATAGCCTTCTCGAGAAGGCTATAGAGCAGCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011527.2-578s21c1
Sequence:CCGGCACTAGGCAGTGGGTTCTTTGCTCGAGCAAAGAACCCACTGCCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011527.2-1211s21c1
Sequence:CCGGGAAGCAGGTCAATGGACTTATCTCGAGATAAGTCCATTGACCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011527.2-678s21c1
Sequence:CCGGTGATGGTCCTCACACCAAAGTCTCGAGACTTTGGTGTGAGGACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011527
TAL1 MISSION shRNA shRNA Plasmid DNA
T-cell acute lymphocytic leukemia 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-831s1c1
Sequence:CCGGCCTTGCCATGAAGTACATCAACTCGAGTTGATGTACTTCATGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-733s1c1
Sequence:CCGGTGGAGGCAGCAGAATGTGAATCTCGAGATTCACATTCTGCTGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-169s1c1
Sequence:CCGGGCACGCAGTGACCCGCAACTACTCGAGTAGTTGCGGGTCACTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-370s1c1
Sequence:CCGGCGCGACGCAGTAGCAGCCGAACTCGAGTTCGGCTGCTACTGCGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-541s1c1
Sequence:CCGGCGAGCGCTGCTCTATAGCCTTCTCGAGAAGGCTATAGAGCAGCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011527.2-578s21c1
Sequence:CCGGCACTAGGCAGTGGGTTCTTTGCTCGAGCAAAGAACCCACTGCCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011527.2-1211s21c1
Sequence:CCGGGAAGCAGGTCAATGGACTTATCTCGAGATAAGTCCATTGACCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011527.2-678s21c1
Sequence:CCGGTGATGGTCCTCACACCAAAGTCTCGAGACTTTGGTGTGAGGACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011527
TAL1 MISSION shRNA Lentiviral Transduction Particles
T-cell acute lymphocytic leukemia 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-831s1c1
Sequence:CCGGCCTTGCCATGAAGTACATCAACTCGAGTTGATGTACTTCATGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-733s1c1
Sequence:CCGGTGGAGGCAGCAGAATGTGAATCTCGAGATTCACATTCTGCTGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-169s1c1
Sequence:CCGGGCACGCAGTGACCCGCAACTACTCGAGTAGTTGCGGGTCACTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-370s1c1
Sequence:CCGGCGCGACGCAGTAGCAGCCGAACTCGAGTTCGGCTGCTACTGCGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011527.1-541s1c1
Sequence:CCGGCGAGCGCTGCTCTATAGCCTTCTCGAGAAGGCTATAGAGCAGCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011527.2-578s21c1
Sequence:CCGGCACTAGGCAGTGGGTTCTTTGCTCGAGCAAAGAACCCACTGCCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011527.2-1211s21c1
Sequence:CCGGGAAGCAGGTCAATGGACTTATCTCGAGATAAGTCCATTGACCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011527.2-678s21c1
Sequence:CCGGTGATGGTCCTCACACCAAAGTCTCGAGACTTTGGTGTGAGGACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003189
VALIDATED
TAL1 MISSION shRNA Bacterial Glycerol Stock
T-cell acute lymphocytic leukemia 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003189.1-3799s1c1
Sequence:CCGGGCCCAGCATTTGGGTAATTTACTCGAGTAAATTACCCAAATGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_003189.1-1051s1c1
Sequence:CCGGCCCTATGTTCACCACCAACAACTCGAGTTGTTGGTGGTGAACATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_003189.1-1243s1c1
Sequence:CCGGGCTCAGCAAGAATGAGATCCTCTCGAGAGGATCTCATTCTTGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003189.1-673s1c1
Sequence:CCGGCCTGCTGAACGGCGTCGCCAACTCGAGTTGGCGACGCCGTTCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003189.1-1060s1c1
Sequence:CCGGCACCACCAACAATCGAGTGAACTCGAGTTCACTCGATTGTTGGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1127s21c1
Sequence:CCGGACCAAAGTTGTGCGGCGTATCCTCGAGGATACGCCGCACAACTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1095s21c1
Sequence:CCGGCCTATGAGATGGAGATTACTGCTCGAGCAGTAATCTCCATCTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1069s21c1
Sequence:CCGGCAATCGAGTGAAGAGGAGACCCTCGAGGGTCTCCTCTTCACTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1266s21c1
Sequence:CCGGGCCTGGCCATGAAGTATATCACTCGAGTGATATACTTCATGGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1137s21c1
Sequence:CCGGTGCGGCGTATCTTCACCAACACTCGAGTGTTGGTGAAGATACGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1297s21c1
Sequence:CCGGCAAGCTGCTCAATGACCAGGACTCGAGTCCTGGTCATTGAGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003189
VALIDATED
TAL1 MISSION shRNA shRNA Plasmid DNA
T-cell acute lymphocytic leukemia 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003189.1-3799s1c1
Sequence:CCGGGCCCAGCATTTGGGTAATTTACTCGAGTAAATTACCCAAATGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_003189.1-1051s1c1
Sequence:CCGGCCCTATGTTCACCACCAACAACTCGAGTTGTTGGTGGTGAACATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_003189.1-1243s1c1
Sequence:CCGGGCTCAGCAAGAATGAGATCCTCTCGAGAGGATCTCATTCTTGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003189.1-673s1c1
Sequence:CCGGCCTGCTGAACGGCGTCGCCAACTCGAGTTGGCGACGCCGTTCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003189.1-1060s1c1
Sequence:CCGGCACCACCAACAATCGAGTGAACTCGAGTTCACTCGATTGTTGGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1127s21c1
Sequence:CCGGACCAAAGTTGTGCGGCGTATCCTCGAGGATACGCCGCACAACTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1095s21c1
Sequence:CCGGCCTATGAGATGGAGATTACTGCTCGAGCAGTAATCTCCATCTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1069s21c1
Sequence:CCGGCAATCGAGTGAAGAGGAGACCCTCGAGGGTCTCCTCTTCACTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1266s21c1
Sequence:CCGGGCCTGGCCATGAAGTATATCACTCGAGTGATATACTTCATGGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1137s21c1
Sequence:CCGGTGCGGCGTATCTTCACCAACACTCGAGTGTTGGTGAAGATACGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1297s21c1
Sequence:CCGGCAAGCTGCTCAATGACCAGGACTCGAGTCCTGGTCATTGAGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003189
VALIDATED
TAL1 MISSION shRNA Lentiviral Transduction Particles
T-cell acute lymphocytic leukemia 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003189.1-3799s1c1
Sequence:CCGGGCCCAGCATTTGGGTAATTTACTCGAGTAAATTACCCAAATGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_003189.1-1051s1c1
Sequence:CCGGCCCTATGTTCACCACCAACAACTCGAGTTGTTGGTGGTGAACATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_003189.1-1243s1c1
Sequence:CCGGGCTCAGCAAGAATGAGATCCTCTCGAGAGGATCTCATTCTTGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003189.1-673s1c1
Sequence:CCGGCCTGCTGAACGGCGTCGCCAACTCGAGTTGGCGACGCCGTTCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003189.1-1060s1c1
Sequence:CCGGCACCACCAACAATCGAGTGAACTCGAGTTCACTCGATTGTTGGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1127s21c1
Sequence:CCGGACCAAAGTTGTGCGGCGTATCCTCGAGGATACGCCGCACAACTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1095s21c1
Sequence:CCGGCCTATGAGATGGAGATTACTGCTCGAGCAGTAATCTCCATCTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1069s21c1
Sequence:CCGGCAATCGAGTGAAGAGGAGACCCTCGAGGGTCTCCTCTTCACTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1266s21c1
Sequence:CCGGGCCTGGCCATGAAGTATATCACTCGAGTGATATACTTCATGGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1137s21c1
Sequence:CCGGTGCGGCGTATCTTCACCAACACTCGAGTGTTGGTGAAGATACGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003189.2-1297s21c1
Sequence:CCGGCAAGCTGCTCAATGACCAGGACTCGAGTCCTGGTCATTGAGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks