EMAIL THIS PAGE TO A FRIEND

TAL2

T-cell acute lymphocytic leukemia 2

UniProtKB ID: Q16559, A0AVI7
Gene ID:
Human(6887) Summary: This intronless gene encodes a helix-loop-helix protein. Translocations between this gene on chromosome 9 and the T-cell receptor beta-chain locus on chromosome 7 have been associated with activation of the T-cell acute lymphocytic leukemia 2 gene and T-cell acute lymphoblastic leukemia. [provided by RefSeq, Mar 2009]
Mouse(21350) T cell acute lymphocytic leukemia 2
Rat(685229) T-cell acute lymphocytic leukemia 2
domestic guinea pig(100722167) T-cell acute lymphocytic leukemia 2
naked mole-rat(101700644) T-cell acute lymphocytic leukemia 2
cow(524755) T-cell acute lymphocytic leukemia 2
sheep(101117728) T-cell acute lymphocytic leukemia 2
Zebrafish(394239) T-cell acute lymphocytic leukemia 2
domestic cat(101084913) T-cell acute lymphocytic leukemia 2
dog(100686129) T-cell acute lymphocytic leukemia 2
chicken(427304) T-cell acute lymphocytic leukemia 2
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009317 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009317 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009317 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005421 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101901 MISSION® esiRNA esiRNA human TAL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005421 Rosetta Predictions human pricing
NM_001109462 Rosetta Predictions rat pricing
NM_009317 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228324 predicted 126
2 SASI_Hs01_00228325 predicted 129
3 SASI_Hs01_00228326 predicted 281
4 SASI_Hs01_00228327 predicted 261
5 SASI_Hs01_00228328 predicted 119
6 SASI_Hs01_00228329 predicted 262
7 SASI_Hs01_00228330 predicted 130
8 SASI_Hs01_00228331 predicted 123
9 SASI_Hs01_00228332 predicted 129
10 SASI_Hs02_00339561 predicted 49
11 SASI_Hs01_00228333 predicted 183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248647 predicted 330
2 SASI_Rn02_00248648 predicted 199
3 SASI_Rn02_00248649 predicted 271
4 SASI_Rn02_00248650 predicted 325
5 SASI_Rn02_00248651 predicted 199
6 SASI_Rn02_00248652 predicted 897
7 SASI_Rn02_00248653 predicted 873
8 SASI_Rn02_00248654 predicted 215
9 SASI_Rn02_00248655 predicted 757
10 SASI_Rn02_00248656 predicted 81
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063742 predicted 623
2 SASI_Mm01_00063743 predicted 529
3 SASI_Mm01_00063744 predicted 894
4 SASI_Mm01_00063745 predicted 340
5 SASI_Mm01_00063746 predicted 683
6 SASI_Mm01_00063747 predicted 251
7 SASI_Mm01_00063748 predicted 759
8 SASI_Mm01_00063749 predicted 470
9 SASI_Mm01_00063750 predicted 729
10 SASI_Mm01_00063751 predicted 337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009317
TAL2 MISSION shRNA Bacterial Glycerol Stock
T-cell acute lymphocytic leukemia 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009317.3-846s21c1
Sequence:CCGGAGCAGAGCAGTGAGGATTATGCTCGAGCATAATCCTCACTGCTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009317.3-204s21c1
Sequence:CCGGAGACGCTTCGCTTGGCAATGACTCGAGTCATTGCCAAGCGAAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009317.3-280s21c1
Sequence:CCGGAGTCGCTGCTCAGGGAAACATCTCGAGATGTTTCCCTGAGCAGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009317.3-732s21c1
Sequence:CCGGGCGTTTGATGGGAGGCAAATACTCGAGTATTTGCCTCCCATCAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009317.2-486s1c1
Sequence:CCGGCGGAAGTGACAAAGTGATGAACTCGAGTTCATCACTTTGTCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009317.2-227s1c1
Sequence:CCGGGTATATCAACTTCTTGGTCAACTCGAGTTGACCAAGAAGTTGATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009317.2-336s1c1
Sequence:CCGGGATGAGGATGACAGAACTCTACTCGAGTAGAGTTCTGTCATCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009317.2-354s1c1
Sequence:CCGGCTACTGAATGACTACCGAGTTCTCGAGAACTCGGTAGTCATTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009317.2-126s1c1
Sequence:CCGGCAGAGTGTCAACAATGCCTTTCTCGAGAAAGGCATTGTTGACACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009317
TAL2 MISSION shRNA shRNA Plasmid DNA
T-cell acute lymphocytic leukemia 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009317.3-846s21c1
Sequence:CCGGAGCAGAGCAGTGAGGATTATGCTCGAGCATAATCCTCACTGCTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009317.3-204s21c1
Sequence:CCGGAGACGCTTCGCTTGGCAATGACTCGAGTCATTGCCAAGCGAAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009317.3-280s21c1
Sequence:CCGGAGTCGCTGCTCAGGGAAACATCTCGAGATGTTTCCCTGAGCAGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009317.3-732s21c1
Sequence:CCGGGCGTTTGATGGGAGGCAAATACTCGAGTATTTGCCTCCCATCAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009317.2-486s1c1
Sequence:CCGGCGGAAGTGACAAAGTGATGAACTCGAGTTCATCACTTTGTCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009317.2-227s1c1
Sequence:CCGGGTATATCAACTTCTTGGTCAACTCGAGTTGACCAAGAAGTTGATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009317.2-336s1c1
Sequence:CCGGGATGAGGATGACAGAACTCTACTCGAGTAGAGTTCTGTCATCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009317.2-354s1c1
Sequence:CCGGCTACTGAATGACTACCGAGTTCTCGAGAACTCGGTAGTCATTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009317.2-126s1c1
Sequence:CCGGCAGAGTGTCAACAATGCCTTTCTCGAGAAAGGCATTGTTGACACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009317
TAL2 MISSION shRNA Lentiviral Transduction Particles
T-cell acute lymphocytic leukemia 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009317.3-846s21c1
Sequence:CCGGAGCAGAGCAGTGAGGATTATGCTCGAGCATAATCCTCACTGCTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009317.3-204s21c1
Sequence:CCGGAGACGCTTCGCTTGGCAATGACTCGAGTCATTGCCAAGCGAAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009317.3-280s21c1
Sequence:CCGGAGTCGCTGCTCAGGGAAACATCTCGAGATGTTTCCCTGAGCAGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009317.3-732s21c1
Sequence:CCGGGCGTTTGATGGGAGGCAAATACTCGAGTATTTGCCTCCCATCAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009317.2-486s1c1
Sequence:CCGGCGGAAGTGACAAAGTGATGAACTCGAGTTCATCACTTTGTCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009317.2-227s1c1
Sequence:CCGGGTATATCAACTTCTTGGTCAACTCGAGTTGACCAAGAAGTTGATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009317.2-336s1c1
Sequence:CCGGGATGAGGATGACAGAACTCTACTCGAGTAGAGTTCTGTCATCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009317.2-354s1c1
Sequence:CCGGCTACTGAATGACTACCGAGTTCTCGAGAACTCGGTAGTCATTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009317.2-126s1c1
Sequence:CCGGCAGAGTGTCAACAATGCCTTTCTCGAGAAAGGCATTGTTGACACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005421
TAL2 MISSION shRNA Bacterial Glycerol Stock
T-cell acute lymphocytic leukemia 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005421.2-315s21c1
Sequence:CCGGTGCTTGAGAACTACCAGGTTCCTCGAGGAACCTGGTAGTTCTCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005421.2-394s21c1
Sequence:CCGGGCAGCACTTGCCCAGAAATCACTCGAGTGATTTCTGGGCAAGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-46s1c1
Sequence:CCGGCAGAATGTCAACAGCGCCTTTCTCGAGAAAGGCGCTGTTGACATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-66s1c1
Sequence:CCGGTGCCAAGCTGAGGAAGCTCATCTCGAGATGAGCTTCCTCAGCTTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-123s1c1
Sequence:CCGGTGAAACGCTTCGCCTGGCAATCTCGAGATTGCCAGGCGAAGCGTTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-153s1c1
Sequence:CCGGCAACTTCTTGGTCAAGGTCTTCTCGAGAAGACCTTGACCAAGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-135s1c1
Sequence:CCGGCCTGGCAATGAGGTATATCAACTCGAGTTGATATACCTCATTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005421
TAL2 MISSION shRNA shRNA Plasmid DNA
T-cell acute lymphocytic leukemia 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005421.2-315s21c1
Sequence:CCGGTGCTTGAGAACTACCAGGTTCCTCGAGGAACCTGGTAGTTCTCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005421.2-394s21c1
Sequence:CCGGGCAGCACTTGCCCAGAAATCACTCGAGTGATTTCTGGGCAAGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-46s1c1
Sequence:CCGGCAGAATGTCAACAGCGCCTTTCTCGAGAAAGGCGCTGTTGACATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-66s1c1
Sequence:CCGGTGCCAAGCTGAGGAAGCTCATCTCGAGATGAGCTTCCTCAGCTTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-123s1c1
Sequence:CCGGTGAAACGCTTCGCCTGGCAATCTCGAGATTGCCAGGCGAAGCGTTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-153s1c1
Sequence:CCGGCAACTTCTTGGTCAAGGTCTTCTCGAGAAGACCTTGACCAAGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-135s1c1
Sequence:CCGGCCTGGCAATGAGGTATATCAACTCGAGTTGATATACCTCATTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005421
TAL2 MISSION shRNA Lentiviral Transduction Particles
T-cell acute lymphocytic leukemia 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005421.2-315s21c1
Sequence:CCGGTGCTTGAGAACTACCAGGTTCCTCGAGGAACCTGGTAGTTCTCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005421.2-394s21c1
Sequence:CCGGGCAGCACTTGCCCAGAAATCACTCGAGTGATTTCTGGGCAAGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-46s1c1
Sequence:CCGGCAGAATGTCAACAGCGCCTTTCTCGAGAAAGGCGCTGTTGACATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-66s1c1
Sequence:CCGGTGCCAAGCTGAGGAAGCTCATCTCGAGATGAGCTTCCTCAGCTTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-123s1c1
Sequence:CCGGTGAAACGCTTCGCCTGGCAATCTCGAGATTGCCAGGCGAAGCGTTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-153s1c1
Sequence:CCGGCAACTTCTTGGTCAAGGTCTTCTCGAGAAGACCTTGACCAAGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005421.1-135s1c1
Sequence:CCGGCCTGGCAATGAGGTATATCAACTCGAGTTGATATACCTCATTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks