EMAIL THIS PAGE TO A FRIEND

TALDO1

transaldolase 1

Synonyms: TAL TAL-H TALDOR TALH
UniProtKB ID: P37837, B2R8M2, O00751, Q8WV32, Q8WZ45
Gene ID:
Human(6888) Summary: Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sulfhydryl groups and cellular integrity from oxygen radicals. The functional gene of transaldolase 1 is located on chromosome 11 and a pseudogene is identified on chromosome 1 but there are conflicting map locations. The second and third exon of this gene were developed by insertion of a retrotransposable element. This gene is thought to be involved in multiple sclerosis. [provided by RefSeq, Jul 2008]
Mouse(21351) transaldolase 1
Rat(83688) transaldolase 1
Zebrafish(324556) transaldolase 1
chicken(423019) transaldolase 1
domestic cat(101083034) transaldolase 1
dog(475937) transaldolase 1
cow(513453) transaldolase 1
sheep(100135441) transaldolase 1
naked mole-rat(101705665) transaldolase 1
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006755 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015951 MISSION® esiRNA esiRNA targeting human TALDO1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006755 Rosetta Predictions human pricing
NM_031811 Rosetta Predictions rat pricing
NM_011528 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064970 predicted 267
2 SASI_Hs01_00064971 predicted 540
3 SASI_Hs01_00064972 predicted 969
4 SASI_Hs01_00064974 predicted 758
5 SASI_Hs01_00064975 predicted 476
6 SASI_Hs01_00064976 predicted 455
7 SASI_Hs01_00064977 predicted 445
8 SASI_Hs01_00064978 predicted 987
9 SASI_Hs01_00064979 predicted 755
10 SASI_Hs02_00342232 predicted 451
11 SASI_Hs01_00064973 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091051 predicted 852
2 SASI_Rn01_00091052 predicted 387
3 SASI_Rn01_00091054 predicted 390
4 SASI_Rn01_00091055 predicted 931
5 SASI_Rn01_00091056 predicted 968
6 SASI_Rn01_00091058 predicted 421
7 SASI_Rn01_00091059 predicted 700
8 SASI_Rn01_00091060 predicted 594
9 SASI_Rn02_00265269 predicted 339
10 SASI_Rn02_00265270 predicted 912
11 SASI_Rn01_00091053 predicted 477
12 SASI_Rn01_00091057 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168052 predicted 941
2 SASI_Mm01_00168055 predicted 417
3 SASI_Mm01_00168056 predicted 973
4 SASI_Mm01_00168057 predicted 228
5 SASI_Mm01_00168058 predicted 585
6 SASI_Mm02_00320848 predicted 330
7 SASI_Mm01_00168059 predicted 904
8 SASI_Mm01_00168060 predicted 607
9 SASI_Mm02_00320849 predicted 690
10 SASI_Mm02_00320850 predicted 725
11 SASI_Mm01_00168051 predicted 279
12 SASI_Mm01_00168053 predicted 612
13 SASI_Mm01_00168054 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011528
TALDO1 MISSION shRNA Bacterial Glycerol Stock
transaldolase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011528.1-1085s1c1
Sequence:CCGGCCTTTGAGCTGGGTCCTAATTCTCGAGAATTAGGACCCAGCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011528.1-677s1c1
Sequence:CCGGCTACAACTACTACAAGAAGTTCTCGAGAACTTCTTGTAGTAGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011528.1-905s1c1
Sequence:CCGGGCTGCACAACGAAGACCAAATCTCGAGATTTGGTCTTCGTTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011528.3-302s21c1
Sequence:CCGGGAAGATTCCAGGCCGTGTATCCTCGAGGATACACGGCCTGGAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011528.3-936s21c1
Sequence:CCGGTCCGACGGCATCCGCAAATTTCTCGAGAAATTTGCGGATGCCGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011528.3-101s21c1
Sequence:CCGGTTTCAATGCCATCGATGAATACTCGAGTATTCATCGATGGCATTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011528.3-1079s21c1
Sequence:CCGGCCTTTGAGCTGGGTCCTAATTCTCGAGAATTAGGACCCAGCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011528.3-234s21c1
Sequence:CCGGCCTCAAGAGGAGCAGATTAAACTCGAGTTTAATCTGCTCCTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011528
TALDO1 MISSION shRNA shRNA Plasmid DNA
transaldolase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011528.1-1085s1c1
Sequence:CCGGCCTTTGAGCTGGGTCCTAATTCTCGAGAATTAGGACCCAGCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011528.1-677s1c1
Sequence:CCGGCTACAACTACTACAAGAAGTTCTCGAGAACTTCTTGTAGTAGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011528.1-905s1c1
Sequence:CCGGGCTGCACAACGAAGACCAAATCTCGAGATTTGGTCTTCGTTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011528.3-302s21c1
Sequence:CCGGGAAGATTCCAGGCCGTGTATCCTCGAGGATACACGGCCTGGAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011528.3-936s21c1
Sequence:CCGGTCCGACGGCATCCGCAAATTTCTCGAGAAATTTGCGGATGCCGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011528.3-101s21c1
Sequence:CCGGTTTCAATGCCATCGATGAATACTCGAGTATTCATCGATGGCATTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011528.3-1079s21c1
Sequence:CCGGCCTTTGAGCTGGGTCCTAATTCTCGAGAATTAGGACCCAGCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011528.3-234s21c1
Sequence:CCGGCCTCAAGAGGAGCAGATTAAACTCGAGTTTAATCTGCTCCTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011528
TALDO1 MISSION shRNA Lentiviral Transduction Particles
transaldolase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011528.1-1085s1c1
Sequence:CCGGCCTTTGAGCTGGGTCCTAATTCTCGAGAATTAGGACCCAGCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011528.1-677s1c1
Sequence:CCGGCTACAACTACTACAAGAAGTTCTCGAGAACTTCTTGTAGTAGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011528.1-905s1c1
Sequence:CCGGGCTGCACAACGAAGACCAAATCTCGAGATTTGGTCTTCGTTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011528.3-302s21c1
Sequence:CCGGGAAGATTCCAGGCCGTGTATCCTCGAGGATACACGGCCTGGAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011528.3-936s21c1
Sequence:CCGGTCCGACGGCATCCGCAAATTTCTCGAGAAATTTGCGGATGCCGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011528.3-101s21c1
Sequence:CCGGTTTCAATGCCATCGATGAATACTCGAGTATTCATCGATGGCATTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011528.3-1079s21c1
Sequence:CCGGCCTTTGAGCTGGGTCCTAATTCTCGAGAATTAGGACCCAGCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011528.3-234s21c1
Sequence:CCGGCCTCAAGAGGAGCAGATTAAACTCGAGTTTAATCTGCTCCTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006755
VALIDATED
TALDO1 MISSION shRNA Bacterial Glycerol Stock
transaldolase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006755.1-374s1c1
Sequence:CCGGCGCAAGGCTCTCCTTTGATAACTCGAGTTATCAAAGGAGAGCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006755.1-539s1c1
Sequence:CCGGCTGCAACATGACGTTACTCTTCTCGAGAAGAGTAACGTCATGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006755.1-1019s1c1
Sequence:CCGGGCGGATGCTGACAGAACGAATCTCGAGATTCGTTCTGTCAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006755.1-911s1c1
Sequence:CCGGCCACCTGGATGAGAAGTCTTTCTCGAGAAAGACTTCTCATCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006755.1-710s1c1
Sequence:CCGGCTACAACTACTACAAGAAGTTCTCGAGAACTTCTTGTAGTAGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-539s21c1
Sequence:CCGGCTGCAACATGACGTTACTCTTCTCGAGAAGAGTAACGTCATGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-911s21c1
Sequence:CCGGCCACCTGGATGAGAAGTCTTTCTCGAGAAAGACTTCTCATCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-1019s21c1
Sequence:CCGGGCGGATGCTGACAGAACGAATCTCGAGATTCGTTCTGTCAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-710s21c1
Sequence:CCGGCTACAACTACTACAAGAAGTTCTCGAGAACTTCTTGTAGTAGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-374s21c1
Sequence:CCGGCGCAAGGCTCTCCTTTGATAACTCGAGTTATCAAAGGAGAGCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006755
VALIDATED
TALDO1 MISSION shRNA shRNA Plasmid DNA
transaldolase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006755.1-374s1c1
Sequence:CCGGCGCAAGGCTCTCCTTTGATAACTCGAGTTATCAAAGGAGAGCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006755.1-539s1c1
Sequence:CCGGCTGCAACATGACGTTACTCTTCTCGAGAAGAGTAACGTCATGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006755.1-1019s1c1
Sequence:CCGGGCGGATGCTGACAGAACGAATCTCGAGATTCGTTCTGTCAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006755.1-911s1c1
Sequence:CCGGCCACCTGGATGAGAAGTCTTTCTCGAGAAAGACTTCTCATCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006755.1-710s1c1
Sequence:CCGGCTACAACTACTACAAGAAGTTCTCGAGAACTTCTTGTAGTAGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-539s21c1
Sequence:CCGGCTGCAACATGACGTTACTCTTCTCGAGAAGAGTAACGTCATGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-911s21c1
Sequence:CCGGCCACCTGGATGAGAAGTCTTTCTCGAGAAAGACTTCTCATCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-1019s21c1
Sequence:CCGGGCGGATGCTGACAGAACGAATCTCGAGATTCGTTCTGTCAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-710s21c1
Sequence:CCGGCTACAACTACTACAAGAAGTTCTCGAGAACTTCTTGTAGTAGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-374s21c1
Sequence:CCGGCGCAAGGCTCTCCTTTGATAACTCGAGTTATCAAAGGAGAGCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006755
VALIDATED
TALDO1 MISSION shRNA Lentiviral Transduction Particles
transaldolase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006755.1-374s1c1
Sequence:CCGGCGCAAGGCTCTCCTTTGATAACTCGAGTTATCAAAGGAGAGCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006755.1-539s1c1
Sequence:CCGGCTGCAACATGACGTTACTCTTCTCGAGAAGAGTAACGTCATGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006755.1-1019s1c1
Sequence:CCGGGCGGATGCTGACAGAACGAATCTCGAGATTCGTTCTGTCAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006755.1-911s1c1
Sequence:CCGGCCACCTGGATGAGAAGTCTTTCTCGAGAAAGACTTCTCATCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006755.1-710s1c1
Sequence:CCGGCTACAACTACTACAAGAAGTTCTCGAGAACTTCTTGTAGTAGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-539s21c1
Sequence:CCGGCTGCAACATGACGTTACTCTTCTCGAGAAGAGTAACGTCATGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-911s21c1
Sequence:CCGGCCACCTGGATGAGAAGTCTTTCTCGAGAAAGACTTCTCATCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-1019s21c1
Sequence:CCGGGCGGATGCTGACAGAACGAATCTCGAGATTCGTTCTGTCAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-710s21c1
Sequence:CCGGCTACAACTACTACAAGAAGTTCTCGAGAACTTCTTGTAGTAGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006755.1-374s21c1
Sequence:CCGGCGCAAGGCTCTCCTTTGATAACTCGAGTTATCAAAGGAGAGCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks