EMAIL THIS PAGE TO A FRIEND

TANC1

tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1

Synonyms: ROLSB TANC
UniProtKB ID: Q9C0D5, C9JD88, Q49AI8
Gene ID:
Mouse(66860) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Rat(311055) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
chicken(424330) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
dog(478760) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
domestic cat(101092704) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Horse(100059992) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
naked mole-rat(101705811) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Domestic Rabbit(100359036) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
domestic guinea pig(100723591) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
cow(507983) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
sheep(101111614) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198294 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198294 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198294 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033394 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033394 Rosetta Predictions human pricing
NM_001002854 Rosetta Predictions rat pricing
NM_198294 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361260 predicted 3798
2 SASI_Hs01_00212231 predicted 2441
3 SASI_Hs01_00212232 predicted 5298
4 SASI_Hs01_00212234 predicted 2148
5 SASI_Hs01_00212237 predicted 2074
6 SASI_Hs01_00212238 predicted 468
7 SASI_Hs01_00212239 predicted 4610
8 SASI_Hs01_00212240 predicted 4575
9 SASI_Hs02_00361261 predicted 3929
10 SASI_Hs02_00361262 predicted 2473
11 SASI_Hs01_00212233 predicted 4347
12 SASI_Hs01_00212235 predicted 2896
13 SASI_Hs01_00212236 predicted 4365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087456 predicted 3929
2 SASI_Rn01_00087457 predicted 1059
3 SASI_Rn02_00198027 predicted 235
4 SASI_Rn01_00087458 predicted 309
5 SASI_Rn01_00087460 predicted 2607
6 SASI_Rn01_00087461 predicted 1039
7 SASI_Rn01_00087462 predicted 1851
8 SASI_Rn01_00087463 predicted 2808
9 SASI_Rn01_00087464 predicted 1022
10 SASI_Rn01_00087465 predicted 1861
11 SASI_Rn01_00087459 predicted 4138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198294 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180207 predicted 5286
2 SASI_Mm01_00180208 predicted 2438
3 SASI_Mm01_00180209 predicted 462
4 SASI_Mm01_00180211 predicted 1420
5 SASI_Mm02_00350905 predicted 2782
6 SASI_Mm01_00180212 predicted 397
7 SASI_Mm01_00180213 predicted 1219
8 SASI_Mm02_00350906 predicted 1175
9 SASI_Mm01_00180214 predicted 5812
10 SASI_Mm01_00180215 predicted 1194
11 SASI_Mm01_00180210 predicted 2472
12 SASI_Mm01_00180216 predicted 4733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198294
VALIDATED
TANC1 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198294.2-5550s1c1
Sequence:CCGGCCTGCAGTCTAACTCTGAGAACTCGAGTTCTCAGAGTTAGACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198294.2-2056s1c1
Sequence:CCGGGCTGAGTTTCATAAGCCTGATCTCGAGATCAGGCTTATGAAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198294.2-7318s1c1
Sequence:CCGGCCAGTTACTATGGCTTATTTACTCGAGTAAATAAGCCATAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198294.2-6120s1c1
Sequence:CCGGCCGTTCTCTTAGGAGATTATTCTCGAGAATAATCTCCTAAGAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198294.2-4100s1c1
Sequence:CCGGCCACTTCCAAGCCTGATATTTCTCGAGAAATATCAGGCTTGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198294.2-4099s1c1
Sequence:CCGGGCCACTTCCAAGCCTGATATTCTCGAGAATATCAGGCTTGGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198294.2-6328s1c1
Sequence:CCGGGCTGGATATAAATGTGACTTTCTCGAGAAAGTCACATTTATATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198294.2-2083s1c1
Sequence:CCGGGATACGCTGTCTTCGTTTATTCTCGAGAATAAACGAAGACAGCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198294.2-2569s21c1
Sequence:CCGGATGACGGATGAGCAGATATTTCTCGAGAAATATCTGCTCATCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198294.2-2084s21c1
Sequence:CCGGATACGCTGTCTTCGTTTATTACTCGAGTAATAAACGAAGACAGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198294.2-2056s21c1
Sequence:CCGGGCTGAGTTTCATAAGCCTGATCTCGAGATCAGGCTTATGAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198294.2-6073s21c1
Sequence:CCGGGCTTATATCTGGCGATTTAAACTCGAGTTTAAATCGCCAGATATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198294.2-4100s21c1
Sequence:CCGGCCACTTCCAAGCCTGATATTTCTCGAGAAATATCAGGCTTGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198294
VALIDATED
TANC1 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198294.2-5550s1c1
Sequence:CCGGCCTGCAGTCTAACTCTGAGAACTCGAGTTCTCAGAGTTAGACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198294.2-2056s1c1
Sequence:CCGGGCTGAGTTTCATAAGCCTGATCTCGAGATCAGGCTTATGAAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198294.2-7318s1c1
Sequence:CCGGCCAGTTACTATGGCTTATTTACTCGAGTAAATAAGCCATAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198294.2-6120s1c1
Sequence:CCGGCCGTTCTCTTAGGAGATTATTCTCGAGAATAATCTCCTAAGAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198294.2-4100s1c1
Sequence:CCGGCCACTTCCAAGCCTGATATTTCTCGAGAAATATCAGGCTTGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198294.2-4099s1c1
Sequence:CCGGGCCACTTCCAAGCCTGATATTCTCGAGAATATCAGGCTTGGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198294.2-6328s1c1
Sequence:CCGGGCTGGATATAAATGTGACTTTCTCGAGAAAGTCACATTTATATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198294.2-2083s1c1
Sequence:CCGGGATACGCTGTCTTCGTTTATTCTCGAGAATAAACGAAGACAGCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198294.2-2569s21c1
Sequence:CCGGATGACGGATGAGCAGATATTTCTCGAGAAATATCTGCTCATCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198294.2-2084s21c1
Sequence:CCGGATACGCTGTCTTCGTTTATTACTCGAGTAATAAACGAAGACAGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198294.2-2056s21c1
Sequence:CCGGGCTGAGTTTCATAAGCCTGATCTCGAGATCAGGCTTATGAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198294.2-6073s21c1
Sequence:CCGGGCTTATATCTGGCGATTTAAACTCGAGTTTAAATCGCCAGATATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198294.2-4100s21c1
Sequence:CCGGCCACTTCCAAGCCTGATATTTCTCGAGAAATATCAGGCTTGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198294
VALIDATED
TANC1 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198294.2-5550s1c1
Sequence:CCGGCCTGCAGTCTAACTCTGAGAACTCGAGTTCTCAGAGTTAGACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198294.2-2056s1c1
Sequence:CCGGGCTGAGTTTCATAAGCCTGATCTCGAGATCAGGCTTATGAAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198294.2-7318s1c1
Sequence:CCGGCCAGTTACTATGGCTTATTTACTCGAGTAAATAAGCCATAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198294.2-6120s1c1
Sequence:CCGGCCGTTCTCTTAGGAGATTATTCTCGAGAATAATCTCCTAAGAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198294.2-4100s1c1
Sequence:CCGGCCACTTCCAAGCCTGATATTTCTCGAGAAATATCAGGCTTGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198294.2-4099s1c1
Sequence:CCGGGCCACTTCCAAGCCTGATATTCTCGAGAATATCAGGCTTGGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198294.2-6328s1c1
Sequence:CCGGGCTGGATATAAATGTGACTTTCTCGAGAAAGTCACATTTATATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198294.2-2083s1c1
Sequence:CCGGGATACGCTGTCTTCGTTTATTCTCGAGAATAAACGAAGACAGCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198294.2-2569s21c1
Sequence:CCGGATGACGGATGAGCAGATATTTCTCGAGAAATATCTGCTCATCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198294.2-2084s21c1
Sequence:CCGGATACGCTGTCTTCGTTTATTACTCGAGTAATAAACGAAGACAGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198294.2-2056s21c1
Sequence:CCGGGCTGAGTTTCATAAGCCTGATCTCGAGATCAGGCTTATGAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198294.2-6073s21c1
Sequence:CCGGGCTTATATCTGGCGATTTAAACTCGAGTTTAAATCGCCAGATATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198294.2-4100s21c1
Sequence:CCGGCCACTTCCAAGCCTGATATTTCTCGAGAAATATCAGGCTTGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033394
VALIDATED
TANC1 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033394.1-6401s1c1
Sequence:CCGGGCAGAATATGAGAACACCTAACTCGAGTTAGGTGTTCTCATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033394.1-1331s1c1
Sequence:CCGGCAGGAAGTTAAAGCACGATTTCTCGAGAAATCGTGCTTTAACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033394.1-3649s1c1
Sequence:CCGGGCAGATTGTTAGACTGCTGTTCTCGAGAACAGCAGTCTAACAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033394.1-2078s1c1
Sequence:CCGGCCTGATTATGGAGATACGCTTCTCGAGAAGCGTATCTCCATAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149388    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033394.1-6616s1c1
Sequence:CCGGGCATTCTTAGTGGCGCTTATACTCGAGTATAAGCGCCACTAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033394.1-2488s1c1
Sequence:CCGGGCTTCAGTGCAACATGAAGTTCTCGAGAACTTCATGTTGCACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033394.1-5822s1c1
Sequence:CCGGGCCAAACCAAAGCGATCATTTCTCGAGAAATGATCGCTTTGGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033394.1-6436s1c1
Sequence:CCGGGCAGTTCCTATAAAGGGATTACTCGAGTAATCCCTTTATAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033394.2-1176s21c1
Sequence:CCGGAGGGCTCCAGCTCACTAATAACTCGAGTTATTAGTGAGCTGGAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033394.2-3056s21c1
Sequence:CCGGTACAGGACAGAAGTGTTAAATCTCGAGATTTAACACTTCTGTCCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033394.2-935s21c1
Sequence:CCGGAGCAAGGACAGTGGAATTATACTCGAGTATAATTCCACTGTCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033394.2-5977s21c1
Sequence:CCGGGATCTGATGCCATTGATATATCTCGAGATATATCAATGGCATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033394.2-5900s21c1
Sequence:CCGGGTTGACTCCTGGTGGTAAATTCTCGAGAATTTACCACCAGGAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033394
VALIDATED
TANC1 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033394.1-6401s1c1
Sequence:CCGGGCAGAATATGAGAACACCTAACTCGAGTTAGGTGTTCTCATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033394.1-1331s1c1
Sequence:CCGGCAGGAAGTTAAAGCACGATTTCTCGAGAAATCGTGCTTTAACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033394.1-3649s1c1
Sequence:CCGGGCAGATTGTTAGACTGCTGTTCTCGAGAACAGCAGTCTAACAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033394.1-2078s1c1
Sequence:CCGGCCTGATTATGGAGATACGCTTCTCGAGAAGCGTATCTCCATAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149388    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033394.1-6616s1c1
Sequence:CCGGGCATTCTTAGTGGCGCTTATACTCGAGTATAAGCGCCACTAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033394.1-2488s1c1
Sequence:CCGGGCTTCAGTGCAACATGAAGTTCTCGAGAACTTCATGTTGCACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033394.1-5822s1c1
Sequence:CCGGGCCAAACCAAAGCGATCATTTCTCGAGAAATGATCGCTTTGGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033394.1-6436s1c1
Sequence:CCGGGCAGTTCCTATAAAGGGATTACTCGAGTAATCCCTTTATAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033394.2-1176s21c1
Sequence:CCGGAGGGCTCCAGCTCACTAATAACTCGAGTTATTAGTGAGCTGGAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033394.2-3056s21c1
Sequence:CCGGTACAGGACAGAAGTGTTAAATCTCGAGATTTAACACTTCTGTCCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033394.2-935s21c1
Sequence:CCGGAGCAAGGACAGTGGAATTATACTCGAGTATAATTCCACTGTCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033394.2-5977s21c1
Sequence:CCGGGATCTGATGCCATTGATATATCTCGAGATATATCAATGGCATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033394.2-5900s21c1
Sequence:CCGGGTTGACTCCTGGTGGTAAATTCTCGAGAATTTACCACCAGGAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033394
VALIDATED
TANC1 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033394.1-6401s1c1
Sequence:CCGGGCAGAATATGAGAACACCTAACTCGAGTTAGGTGTTCTCATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033394.1-1331s1c1
Sequence:CCGGCAGGAAGTTAAAGCACGATTTCTCGAGAAATCGTGCTTTAACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033394.1-3649s1c1
Sequence:CCGGGCAGATTGTTAGACTGCTGTTCTCGAGAACAGCAGTCTAACAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033394.1-2078s1c1
Sequence:CCGGCCTGATTATGGAGATACGCTTCTCGAGAAGCGTATCTCCATAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149388    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033394.1-6616s1c1
Sequence:CCGGGCATTCTTAGTGGCGCTTATACTCGAGTATAAGCGCCACTAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033394.1-2488s1c1
Sequence:CCGGGCTTCAGTGCAACATGAAGTTCTCGAGAACTTCATGTTGCACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033394.1-5822s1c1
Sequence:CCGGGCCAAACCAAAGCGATCATTTCTCGAGAAATGATCGCTTTGGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033394.1-6436s1c1
Sequence:CCGGGCAGTTCCTATAAAGGGATTACTCGAGTAATCCCTTTATAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033394.2-1176s21c1
Sequence:CCGGAGGGCTCCAGCTCACTAATAACTCGAGTTATTAGTGAGCTGGAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033394.2-3056s21c1
Sequence:CCGGTACAGGACAGAAGTGTTAAATCTCGAGATTTAACACTTCTGTCCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033394.2-935s21c1
Sequence:CCGGAGCAAGGACAGTGGAATTATACTCGAGTATAATTCCACTGTCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033394.2-5977s21c1
Sequence:CCGGGATCTGATGCCATTGATATATCTCGAGATATATCAATGGCATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033394.2-5900s21c1
Sequence:CCGGGTTGACTCCTGGTGGTAAATTCTCGAGAATTTACCACCAGGAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks