EMAIL THIS PAGE TO A FRIEND

TANC2

tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2

Synonyms: ROLSA rols
UniProtKB ID: Q9HCD6, Q9HAC3, Q9NW88, Q9NXY9, Q9ULS2
Gene ID:
Mouse(77097) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Rat(303599) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
cow(529494) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
sheep(101102073) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
domestic guinea pig(100733305) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Domestic Rabbit(100347342) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
naked mole-rat(101699452) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Zebrafish(568810) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
chicken(419951) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
dog(480483) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Horse(100054415) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
domestic cat(101093560) tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
399 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA023274 Anti-TANC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025185 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181071 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181071 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181071 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025185 Rosetta Predictions human pricing
XM_371074 Rosetta Predictions human pricing
XM_934927 Rosetta Predictions human pricing
XM_001081577 Rosetta Predictions rat pricing
XM_221028 Rosetta Predictions rat pricing
NM_181071 Rosetta Predictions mouse pricing
XM_001004226 Rosetta Predictions mouse pricing
XM_001004229 Rosetta Predictions mouse pricing
XM_001004235 Rosetta Predictions mouse pricing
XM_001004240 Rosetta Predictions mouse pricing
XM_903099 Rosetta Predictions mouse pricing
XM_903101 Rosetta Predictions mouse pricing
XM_903102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357943 predicted 553
2 SASI_Hs02_00357944 predicted 4747
3 SASI_Hs02_00357945 predicted 399
4 SASI_Hs02_00357946 predicted 1849
5 SASI_Hs02_00357947 predicted 948
6 SASI_Hs02_00357948 predicted 1121
7 SASI_Hs02_00357949 predicted 2206
8 SASI_Hs02_00357950 predicted 2028
9 SASI_Hs02_00357951 predicted 3132
10 SASI_Hs02_00357952 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273311 predicted 376
2 SASI_Hs01_00273312 predicted 4579
3 SASI_Hs01_00273313 predicted 2874
4 SASI_Hs01_00273314 predicted 5892
5 SASI_Hs01_00273315 predicted 1681
6 SASI_Hs01_00273316 predicted 778
7 SASI_Hs01_00273317 predicted 953
8 SASI_Hs01_00273318 predicted 2036
9 SASI_Hs01_00273319 predicted 1857
10 SASI_Hs01_00273320 predicted 2961
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263316 predicted 370
2 SASI_Hs01_00263317 predicted 292
3 SASI_Hs01_00263318 predicted 399
4 SASI_Hs01_00263319 predicted 290
5 SASI_Hs01_00263320 predicted 277
6 SASI_Hs01_00263321 predicted 220
7 SASI_Hs01_00263322 predicted 413
8 SASI_Hs01_00263323 predicted 290
9 SASI_Hs01_00263324 predicted 284
10 SASI_Hs01_00263325 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372545 predicted 6339
2 SASI_Rn02_00372546 predicted 3301
3 SASI_Rn02_00372547 predicted 5423
4 SASI_Rn02_00372548 predicted 645
5 SASI_Rn02_00372549 predicted 3840
6 SASI_Rn02_00372550 predicted 5195
7 SASI_Rn02_00372551 predicted 2104
8 SASI_Rn02_00372552 predicted 2284
9 SASI_Rn02_00372553 predicted 1996
10 SASI_Rn02_00372554 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379764 predicted 3298
2 SASI_Rn02_00379765 predicted 5423
3 SASI_Rn02_00379766 predicted 644
4 SASI_Rn02_00379767 predicted 3839
5 SASI_Rn02_00379768 predicted 5196
6 SASI_Rn02_00379769 predicted 2109
7 SASI_Rn02_00379770 predicted 2288
8 SASI_Rn02_00379771 predicted 1996
9 SASI_Rn02_00379772 predicted 994
10 SASI_Rn02_00379773 predicted 2467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349627 predicted 6256
2 SASI_Mm02_00349628 predicted 3307
3 SASI_Mm02_00349629 predicted 1296
4 SASI_Mm02_00349630 predicted 3853
5 SASI_Mm02_00349631 predicted 2118
6 SASI_Mm02_00349632 predicted 5905
7 SASI_Mm02_00349633 predicted 2295
8 SASI_Mm02_00349634 predicted 1391
9 SASI_Mm02_00349635 predicted 2467
10 SASI_Mm02_00349636 predicted 5245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263630 predicted 3248
2 SASI_Mm01_00263631 predicted 3333
3 SASI_Mm01_00263632 predicted 3339
4 SASI_Mm01_00263633 predicted 296
5 SASI_Mm01_00263634 predicted 2202
6 SASI_Mm01_00263635 predicted 2438
7 SASI_Mm01_00263636 predicted 845
8 SASI_Mm01_00263637 predicted 2894
9 SASI_Mm01_00263638 predicted 2451
10 SASI_Mm01_00263639 predicted 2454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255144 predicted 3063
2 SASI_Mm01_00255145 predicted 2553
3 SASI_Mm01_00255146 predicted 3153
4 SASI_Mm01_00255147 predicted 3156
5 SASI_Mm01_00255148 predicted 2017
6 SASI_Mm01_00255149 predicted 2253
7 SASI_Mm01_00255150 predicted 665
8 SASI_Mm01_00255151 predicted 2718
9 SASI_Mm01_00255152 predicted 2271
10 SASI_Mm01_00255153 predicted 2279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246598 predicted 3302
2 SASI_Mm01_00246599 predicted 1293
3 SASI_Mm01_00246600 predicted 3847
4 SASI_Mm01_00246601 predicted 2112
5 SASI_Mm01_00246602 predicted 2296
6 SASI_Mm01_00246603 predicted 2000
7 SASI_Mm01_00246604 predicted 1395
8 SASI_Mm01_00246605 predicted 4797
9 SASI_Mm01_00246606 predicted 2467
10 SASI_Mm01_00246607 predicted 5276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231450 predicted 3301
2 SASI_Mm01_00231451 predicted 1300
3 SASI_Mm01_00231452 predicted 3849
4 SASI_Mm01_00231453 predicted 2115
5 SASI_Mm01_00231454 predicted 2295
6 SASI_Mm01_00231455 predicted 2003
7 SASI_Mm01_00231456 predicted 1391
8 SASI_Mm01_00231457 predicted 4761
9 SASI_Mm01_00231458 predicted 2475
10 SASI_Mm01_00231459 predicted 5244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279325 predicted 504
2 SASI_Mm01_00279326 predicted 734
3 SASI_Mm01_00279327 predicted 881
4 SASI_Mm01_00279328 predicted 597
5 SASI_Mm01_00279329 predicted 721
6 SASI_Mm01_00279330 predicted 709
7 SASI_Mm01_00279331 predicted 562
8 SASI_Mm01_00279332 predicted 658
9 SASI_Mm01_00279333 predicted 983
10 SASI_Mm01_00279334 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215207 predicted 1113
2 SASI_Mm01_00215208 predicted 1220
3 SASI_Mm01_00215209 predicted 1197
4 SASI_Mm01_00215210 predicted 1285
5 SASI_Mm01_00215211 predicted 1027
6 SASI_Mm01_00215212 predicted 1097
7 SASI_Mm01_00215213 predicted 1166
8 SASI_Mm01_00215214 predicted 985
9 SASI_Mm01_00215215 predicted 988
10 SASI_Mm01_00215216 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210803 predicted 397
2 SASI_Mm01_00210804 predicted 235
3 SASI_Mm01_00210805 predicted 518
4 SASI_Mm01_00210806 predicted 814
5 SASI_Mm01_00210807 predicted 698
6 SASI_Mm01_00210808 predicted 769
7 SASI_Mm01_00210809 predicted 241
8 SASI_Mm01_00210810 predicted 493
9 SASI_Mm01_00210811 predicted 334
10 SASI_Mm01_00210812 predicted 841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025185
VALIDATED
TANC2 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_025185.3-2568s21c1
Sequence:CCGGTCCATGGCACTGGCGTCTTTACTCGAGTAAAGACGCCAGTGCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_025185.3-5761s21c1
Sequence:CCGGATTTGCTGGAGGACGATTATTCTCGAGAATAATCGTCCTCCAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025185.3-2843s21c1
Sequence:CCGGACGGGCCAAGGTGGATCATTTCTCGAGAAATGATCCACCTTGGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025185.3-9346s21c1
Sequence:CCGGGTAGTTAAGCCTGGATTATTACTCGAGTAATAATCCAGGCTTAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025185.3-2959s21c1
Sequence:CCGGGCCAGCAGCAAGGAGTATTTACTCGAGTAAATACTCCTTGCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025185
VALIDATED
TANC2 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_025185.3-2568s21c1
Sequence:CCGGTCCATGGCACTGGCGTCTTTACTCGAGTAAAGACGCCAGTGCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_025185.3-5761s21c1
Sequence:CCGGATTTGCTGGAGGACGATTATTCTCGAGAATAATCGTCCTCCAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025185.3-2843s21c1
Sequence:CCGGACGGGCCAAGGTGGATCATTTCTCGAGAAATGATCCACCTTGGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025185.3-9346s21c1
Sequence:CCGGGTAGTTAAGCCTGGATTATTACTCGAGTAATAATCCAGGCTTAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025185.3-2959s21c1
Sequence:CCGGGCCAGCAGCAAGGAGTATTTACTCGAGTAAATACTCCTTGCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025185
VALIDATED
TANC2 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_025185.3-2568s21c1
Sequence:CCGGTCCATGGCACTGGCGTCTTTACTCGAGTAAAGACGCCAGTGCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_025185.3-5761s21c1
Sequence:CCGGATTTGCTGGAGGACGATTATTCTCGAGAATAATCGTCCTCCAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025185.3-2843s21c1
Sequence:CCGGACGGGCCAAGGTGGATCATTTCTCGAGAAATGATCCACCTTGGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025185.3-9346s21c1
Sequence:CCGGGTAGTTAAGCCTGGATTATTACTCGAGTAATAATCCAGGCTTAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025185.3-2959s21c1
Sequence:CCGGGCCAGCAGCAAGGAGTATTTACTCGAGTAAATACTCCTTGCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181071
TANC2 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181071.3-10697s21c1
Sequence:CCGGAGTACCAAATGAACGTATAATCTCGAGATTATACGTTCATTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181071.3-602s21c1
Sequence:CCGGACAACCAAGTGACCAATATAGCTCGAGCTATATTGGTCACTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181071.3-2896s21c1
Sequence:CCGGTTCTGGGAGGTGCCAATATTACTCGAGTAATATTGGCACCTCCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181071.3-5456s21c1
Sequence:CCGGTAGCCAATCAGCGTCATATTACTCGAGTAATATGACGCTGATTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181071.3-6037s21c1
Sequence:CCGGATTTGCTGGAGGACGATTATTCTCGAGAATAATCGTCCTCCAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181071
TANC2 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181071.3-10697s21c1
Sequence:CCGGAGTACCAAATGAACGTATAATCTCGAGATTATACGTTCATTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181071.3-602s21c1
Sequence:CCGGACAACCAAGTGACCAATATAGCTCGAGCTATATTGGTCACTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181071.3-2896s21c1
Sequence:CCGGTTCTGGGAGGTGCCAATATTACTCGAGTAATATTGGCACCTCCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181071.3-5456s21c1
Sequence:CCGGTAGCCAATCAGCGTCATATTACTCGAGTAATATGACGCTGATTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181071.3-6037s21c1
Sequence:CCGGATTTGCTGGAGGACGATTATTCTCGAGAATAATCGTCCTCCAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181071
TANC2 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181071.3-10697s21c1
Sequence:CCGGAGTACCAAATGAACGTATAATCTCGAGATTATACGTTCATTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181071.3-602s21c1
Sequence:CCGGACAACCAAGTGACCAATATAGCTCGAGCTATATTGGTCACTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181071.3-2896s21c1
Sequence:CCGGTTCTGGGAGGTGCCAATATTACTCGAGTAATATTGGCACCTCCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181071.3-5456s21c1
Sequence:CCGGTAGCCAATCAGCGTCATATTACTCGAGTAATATGACGCTGATTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181071.3-6037s21c1
Sequence:CCGGATTTGCTGGAGGACGATTATTCTCGAGAATAATCGTCCTCCAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks