EMAIL THIS PAGE TO A FRIEND

TANGO2

transport and golgi organization 2 homolog (Drosophila)

Synonyms: C22orf25
Gene ID:
Mouse(27883) transport and golgi organization 2
Rat(360738) transport and golgi organization 2 homolog (Drosophila)
fruit fly(32319) Transport and Golgi organization 2
Zebrafish(445324) transport and golgi organization 2 homolog (Drosophila)
dog(608141) transport and golgi organization 2 homolog (Drosophila)
naked mole-rat(101722743) transport and golgi organization 2 homolog (Drosophila)
domestic guinea pig(100731065) transport and golgi organization 2 homolog (Drosophila)
cow(518209) transport and golgi organization 2 homolog (Drosophila)
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103546 Anti-C22ORF25, (N-terminal) antibody produced in rabbit affinity isolated antibody canine, zebrafish, rabbit, rat, bovine, human, mouse, guinea pig, horse
western blot pricing
HPA003080 Anti-TANGO2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152906 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152906 Rosetta Predictions human pricing
NM_001108323 Rosetta Predictions rat pricing
NM_138583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063998 predicted 975
2 SASI_Hs01_00063999 predicted 753
3 SASI_Hs01_00064001 predicted 244
4 SASI_Hs01_00064002 predicted 397
5 SASI_Hs02_00366876 predicted 572
6 SASI_Hs01_00064003 predicted 885
7 SASI_Hs01_00064004 predicted 466
8 SASI_Hs01_00064005 predicted 921
9 SASI_Hs01_00064006 predicted 624
10 SASI_Hs01_00064007 predicted 921
11 SASI_Hs01_00064000 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237529 predicted 463
2 SASI_Rn02_00237530 predicted 929
3 SASI_Rn02_00237531 predicted 227
4 SASI_Rn02_00237532 predicted 703
5 SASI_Rn02_00237533 predicted 391
6 SASI_Rn02_00237534 predicted 491
7 SASI_Rn02_00237535 predicted 820
8 SASI_Rn02_00237536 predicted 301
9 SASI_Rn02_00237537 predicted 1066
10 SASI_Rn02_00237538 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074809 predicted 493
2 SASI_Mm01_00074810 predicted 847
3 SASI_Mm01_00074811 predicted 434
4 SASI_Mm01_00074812 predicted 847
5 SASI_Mm01_00074813 predicted 682
6 SASI_Mm02_00339637 predicted 324
7 SASI_Mm01_00074815 predicted 929
8 SASI_Mm01_00074816 predicted 312
9 SASI_Mm01_00074817 predicted 621
10 SASI_Mm01_00074818 predicted 780
11 SASI_Mm01_00074814 predicted 397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152906
TANGO2 MISSION shRNA Bacterial Glycerol Stock
transport and golgi organization 2 homolog (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152906.4-1145s21c1
Sequence:CCGGGGTTTGCGTGTTACCCATCTGCTCGAGCAGATGGGTAACACGCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152906.4-931s21c1
Sequence:CCGGCTTCACTGAGCGTAGCATGATCTCGAGATCATGCTACGCTCAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152906.4-1178s21c1
Sequence:CCGGCAGTTCAGGGTCTGCCTTTATCTCGAGATAAAGGCAGACCCTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130981    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152906.2-1811s1c1
Sequence:CCGGCCTCCTGATTAGCTGGGATTACTCGAGTAATCCCAGCTAATCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152906.2-760s1c1
Sequence:CCGGCTGGATGTGCTCAACAATAAACTCGAGTTTATTGTTGAGCACATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152906.2-576s1c1
Sequence:CCGGCGTCATTTGCTACTATGGGAACTCGAGTTCCCATAGTAGCAAATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152906.2-759s1c1
Sequence:CCGGCCTGGATGTGCTCAACAATAACTCGAGTTATTGTTGAGCACATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152906.2-492s1c1
Sequence:CCGGCTACCTGAAGAAGGTCTCTATCTCGAGATAGAGACCTTCTTCAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152906
TANGO2 MISSION shRNA shRNA Plasmid DNA
transport and golgi organization 2 homolog (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152906.4-1145s21c1
Sequence:CCGGGGTTTGCGTGTTACCCATCTGCTCGAGCAGATGGGTAACACGCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152906.4-931s21c1
Sequence:CCGGCTTCACTGAGCGTAGCATGATCTCGAGATCATGCTACGCTCAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152906.4-1178s21c1
Sequence:CCGGCAGTTCAGGGTCTGCCTTTATCTCGAGATAAAGGCAGACCCTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130981    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152906.2-1811s1c1
Sequence:CCGGCCTCCTGATTAGCTGGGATTACTCGAGTAATCCCAGCTAATCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152906.2-760s1c1
Sequence:CCGGCTGGATGTGCTCAACAATAAACTCGAGTTTATTGTTGAGCACATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152906.2-576s1c1
Sequence:CCGGCGTCATTTGCTACTATGGGAACTCGAGTTCCCATAGTAGCAAATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152906.2-759s1c1
Sequence:CCGGCCTGGATGTGCTCAACAATAACTCGAGTTATTGTTGAGCACATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152906.2-492s1c1
Sequence:CCGGCTACCTGAAGAAGGTCTCTATCTCGAGATAGAGACCTTCTTCAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152906
TANGO2 MISSION shRNA Lentiviral Transduction Particles
transport and golgi organization 2 homolog (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152906.4-1145s21c1
Sequence:CCGGGGTTTGCGTGTTACCCATCTGCTCGAGCAGATGGGTAACACGCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152906.4-931s21c1
Sequence:CCGGCTTCACTGAGCGTAGCATGATCTCGAGATCATGCTACGCTCAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152906.4-1178s21c1
Sequence:CCGGCAGTTCAGGGTCTGCCTTTATCTCGAGATAAAGGCAGACCCTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130981    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152906.2-1811s1c1
Sequence:CCGGCCTCCTGATTAGCTGGGATTACTCGAGTAATCCCAGCTAATCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152906.2-760s1c1
Sequence:CCGGCTGGATGTGCTCAACAATAAACTCGAGTTTATTGTTGAGCACATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152906.2-576s1c1
Sequence:CCGGCGTCATTTGCTACTATGGGAACTCGAGTTCCCATAGTAGCAAATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152906.2-759s1c1
Sequence:CCGGCCTGGATGTGCTCAACAATAACTCGAGTTATTGTTGAGCACATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152906.2-492s1c1
Sequence:CCGGCTACCTGAAGAAGGTCTCTATCTCGAGATAGAGACCTTCTTCAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138583
VALIDATED
TANGO2 MISSION shRNA Bacterial Glycerol Stock
transport and golgi organization 2 homolog (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000195871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138583.1-1034s1c1
Sequence:CCGGCCAATGGAGAACGACAGAGTTCTCGAGAACTCTGTCGTTCTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138583.1-387s1c1
Sequence:CCGGGCCACCTGTATAACGGCTTTACTCGAGTAAAGCCGTTATACAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138583.1-476s1c1
Sequence:CCGGCCTGAGCCTATTGTCTTGACACTCGAGTGTCAAGACAATAGGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138583.1-1244s1c1
Sequence:CCGGCCTGTATTTGTTTGTGTTCATCTCGAGATGAACACAAACAAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138583
VALIDATED
TANGO2 MISSION shRNA shRNA Plasmid DNA
transport and golgi organization 2 homolog (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000195871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138583.1-1034s1c1
Sequence:CCGGCCAATGGAGAACGACAGAGTTCTCGAGAACTCTGTCGTTCTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138583.1-387s1c1
Sequence:CCGGGCCACCTGTATAACGGCTTTACTCGAGTAAAGCCGTTATACAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138583.1-476s1c1
Sequence:CCGGCCTGAGCCTATTGTCTTGACACTCGAGTGTCAAGACAATAGGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138583.1-1244s1c1
Sequence:CCGGCCTGTATTTGTTTGTGTTCATCTCGAGATGAACACAAACAAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138583
VALIDATED
TANGO2 MISSION shRNA Lentiviral Transduction Particles
transport and golgi organization 2 homolog (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000195871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138583.1-1034s1c1
Sequence:CCGGCCAATGGAGAACGACAGAGTTCTCGAGAACTCTGTCGTTCTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138583.1-387s1c1
Sequence:CCGGGCCACCTGTATAACGGCTTTACTCGAGTAAAGCCGTTATACAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138583.1-476s1c1
Sequence:CCGGCCTGAGCCTATTGTCTTGACACTCGAGTGTCAAGACAATAGGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138583.1-1244s1c1
Sequence:CCGGCCTGTATTTGTTTGTGTTCATCTCGAGATGAACACAAACAAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks