EMAIL THIS PAGE TO A FRIEND

TANGO6

transport and golgi organization 6 homolog (Drosophila)

Synonyms: TMCO7
UniProtKB ID: Q9C0B7, Q569F9, Q9H9K1
Gene ID:
Mouse(272538) transport and golgi organization 6
fruit fly(35155) Transport and Golgi organization 6
Zebrafish(572623) transport and golgi organization 6 homolog (Drosophila)
chicken(101668394) transport and golgi organization 6 homolog (Drosophila)
chicken(101749604) transport and golgi organization 6 homolog (Drosophila)
cow(534015) transport and golgi organization 6 homolog (Drosophila)
domestic guinea pig(101788114) transport and golgi organization 6 homolog (Drosophila)
naked mole-rat(101697955) transport and golgi organization 6 homolog (Drosophila)
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173037 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173037 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173037 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024562 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024562 Rosetta Predictions human pricing
XM_928235 Rosetta Predictions human pricing
XM_928238 Rosetta Predictions human pricing
NM_173037 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356870 predicted 1645
2 SASI_Hs02_00356871 predicted 2433
3 SASI_Hs02_00356872 predicted 1398
4 SASI_Hs02_00356873 predicted 2826
5 SASI_Hs02_00356874 predicted 1810
6 SASI_Hs02_00356875 predicted 2342
7 SASI_Hs02_00356876 predicted 956
8 SASI_Hs02_00356877 predicted 2905
9 SASI_Hs02_00356878 predicted 1967
10 SASI_Hs02_00356879 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272640 predicted 661
2 SASI_Hs01_00272641 predicted 287
3 SASI_Hs01_00272642 predicted 468
4 SASI_Hs01_00272643 predicted 229
5 SASI_Hs01_00272644 predicted 568
6 SASI_Hs01_00272645 predicted 657
7 SASI_Hs01_00272646 predicted 262
8 SASI_Hs01_00272647 predicted 562
9 SASI_Hs01_00272648 predicted 569
10 SASI_Hs01_00272649 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301593 predicted 764
2 SASI_Hs01_00301594 predicted 1549
3 SASI_Hs01_00301595 predicted 516
4 SASI_Hs01_00301596 predicted 927
5 SASI_Hs01_00301597 predicted 1462
6 SASI_Hs01_00301598 predicted 1567
7 SASI_Hs01_00301599 predicted 219
8 SASI_Hs01_00301600 predicted 618
9 SASI_Hs01_00301601 predicted 1080
10 SASI_Hs01_00301602 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154599 predicted 865
2 SASI_Mm01_00154600 predicted 2764
3 SASI_Mm01_00154601 predicted 2892
4 SASI_Mm01_00154602 predicted 3064
5 SASI_Mm01_00154603 predicted 1231
6 SASI_Mm01_00154604 predicted 1240
7 SASI_Mm01_00154605 predicted 3313
8 SASI_Mm01_00154606 predicted 353
9 SASI_Mm01_00154607 predicted 2433
10 SASI_Mm01_00154608 predicted 1747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173037
TANGO6 MISSION shRNA Bacterial Glycerol Stock
transport and golgi organization 6 homolog (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000178679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173037.1-2330s1c1
Sequence:CCGGCGAATTACCATCTCCACTCATCTCGAGATGAGTGGAGATGGTAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173037.1-370s1c1
Sequence:CCGGGAGTTTCACCTCTCAAACCTTCTCGAGAAGGTTTGAGAGGTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173037.1-198s1c1
Sequence:CCGGCAAGTTCACTACAGAACACAACTCGAGTTGTGTTCTGTAGTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173037.1-2768s1c1
Sequence:CCGGCCTGAAGAAATCTTGGTTGATCTCGAGATCAACCAAGATTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173037
TANGO6 MISSION shRNA shRNA Plasmid DNA
transport and golgi organization 6 homolog (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000178679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173037.1-2330s1c1
Sequence:CCGGCGAATTACCATCTCCACTCATCTCGAGATGAGTGGAGATGGTAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173037.1-370s1c1
Sequence:CCGGGAGTTTCACCTCTCAAACCTTCTCGAGAAGGTTTGAGAGGTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173037.1-198s1c1
Sequence:CCGGCAAGTTCACTACAGAACACAACTCGAGTTGTGTTCTGTAGTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173037.1-2768s1c1
Sequence:CCGGCCTGAAGAAATCTTGGTTGATCTCGAGATCAACCAAGATTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173037
TANGO6 MISSION shRNA Lentiviral Transduction Particles
transport and golgi organization 6 homolog (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000178679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173037.1-2330s1c1
Sequence:CCGGCGAATTACCATCTCCACTCATCTCGAGATGAGTGGAGATGGTAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173037.1-370s1c1
Sequence:CCGGGAGTTTCACCTCTCAAACCTTCTCGAGAAGGTTTGAGAGGTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173037.1-198s1c1
Sequence:CCGGCAAGTTCACTACAGAACACAACTCGAGTTGTGTTCTGTAGTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173037.1-2768s1c1
Sequence:CCGGCCTGAAGAAATCTTGGTTGATCTCGAGATCAACCAAGATTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024562
VALIDATED
TANGO6 MISSION shRNA Bacterial Glycerol Stock
transport and golgi organization 6 homolog (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024562.1-1969s21c1
Sequence:CCGGAGAATGTCTGAGCAGATATTCCTCGAGGAATATCTGCTCAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024562.1-53s21c1
Sequence:CCGGCATGCGGTCTGGATCGGATTTCTCGAGAAATCCGATCCAGACCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024562.1-339s21c1
Sequence:CCGGGATCCGCCTTGCAGCTAATTTCTCGAGAAATTAGCTGCAAGGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024562.1-4463s21c1
Sequence:CCGGCGAGTGACTGAAGGATCTATACTCGAGTATAGATCCTTCAGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024562.1-2754s21c1
Sequence:CCGGGCCGGACTTGTTGGCTCAATACTCGAGTATTGAGCCAACAAGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024562
VALIDATED
TANGO6 MISSION shRNA shRNA Plasmid DNA
transport and golgi organization 6 homolog (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024562.1-1969s21c1
Sequence:CCGGAGAATGTCTGAGCAGATATTCCTCGAGGAATATCTGCTCAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024562.1-53s21c1
Sequence:CCGGCATGCGGTCTGGATCGGATTTCTCGAGAAATCCGATCCAGACCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024562.1-339s21c1
Sequence:CCGGGATCCGCCTTGCAGCTAATTTCTCGAGAAATTAGCTGCAAGGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024562.1-4463s21c1
Sequence:CCGGCGAGTGACTGAAGGATCTATACTCGAGTATAGATCCTTCAGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024562.1-2754s21c1
Sequence:CCGGGCCGGACTTGTTGGCTCAATACTCGAGTATTGAGCCAACAAGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024562
VALIDATED
TANGO6 MISSION shRNA Lentiviral Transduction Particles
transport and golgi organization 6 homolog (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024562.1-1969s21c1
Sequence:CCGGAGAATGTCTGAGCAGATATTCCTCGAGGAATATCTGCTCAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024562.1-53s21c1
Sequence:CCGGCATGCGGTCTGGATCGGATTTCTCGAGAAATCCGATCCAGACCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024562.1-339s21c1
Sequence:CCGGGATCCGCCTTGCAGCTAATTTCTCGAGAAATTAGCTGCAAGGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024562.1-4463s21c1
Sequence:CCGGCGAGTGACTGAAGGATCTATACTCGAGTATAGATCCTTCAGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024562.1-2754s21c1
Sequence:CCGGGCCGGACTTGTTGGCTCAATACTCGAGTATTGAGCCAACAAGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks