EMAIL THIS PAGE TO A FRIEND

TANK

TRAF family member-associated NFKB activator

Synonyms: I-TRAF ITRAF TRAF2
UniProtKB ID: Q92844, D3DPB5, Q7Z4J6, Q92885
Gene ID:
Human(10010) Summary: The TRAF (tumor necrosis factor receptor-associated factor) family of proteins associate with and transduce signals from members of the tumor necrosis factor receptor superfamily. The protein encoded by this gene is found in the cytoplasm and can bind to TRAF1, TRAF2, or TRAF3, thereby inhibiting TRAF function by sequestering the TRAFs in a latent state in the cytoplasm. For example, the protein encoded by this gene can block TRAF2 binding to LMP1, the Epstein-Barr virus transforming protein, and inhibit LMP1-mediated NF-kappa-B activation. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(21353) TRAF family member-associated Nf-kappa B activator
Rat(252961) TRAF family member-associated NFKB activator
cow(539513) TRAF family member-associated NFKB activator
sheep(101108632) TRAF family member-associated NFKB activator
naked mole-rat(101698139) TRAF family member-associated NFKB activator
Domestic Rabbit(100339142) TRAF family member-associated NFKB activator
domestic guinea pig(100721939) TRAF family member-associated NFKB activator
Zebrafish(767660) TRAF family member-associated NFKB activator
dog(608092) TRAF family member-associated NFKB activator
Horse(100068006) TRAF family member-associated NFKB activator
Horse(100051339) TRAF family member-associated NFKB activator
domestic cat(101094867) TRAF family member-associated NFKB activator
chicken(424190) TRAF family member-associated NFKB activator
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS3877 Anti-TANK (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2900286 Anti-TANK (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
PRS3879 Anti-TANK (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunocytochemistry, western blot pricing
SAB2900392 Anti-TANK (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunohistochemistry, western blot pricing
GW21243 Anti-TANK antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
AV38420 Anti-TANK antibody produced in rabbit affinity isolated antibody human, rabbit
western blot pricing
SAB2102369 Anti-TANK antibody produced in rabbit affinity isolated antibody canine, bovine, rat, guinea pig, human, horse, rabbit, mouse
western blot pricing
HPA037675 Anti-TANK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA037676 Anti-TANK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004180 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004180 Rosetta Predictions human pricing
NM_133484 Rosetta Predictions human pricing
NM_145788 Rosetta Predictions rat pricing
NM_011529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136561 predicted 215
2 SASI_Hs01_00136562 predicted 259
3 SASI_Hs01_00136563 predicted 420
4 SASI_Hs02_00337060 predicted 212
5 SASI_Hs01_00136565 predicted 639
6 SASI_Hs01_00136566 predicted 1313
7 SASI_Hs01_00136567 predicted 442
8 SASI_Hs01_00136568 predicted 1319
9 SASI_Hs01_00136569 predicted 295
10 SASI_Hs02_00337061 predicted 624
11 SASI_Hs01_00136560 predicted 881
12 SASI_Hs01_00136564 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117999 predicted 216
2 SASI_Hs01_00118000 predicted 256
3 SASI_Hs01_00118001 predicted 420
4 SASI_Hs01_00118002 predicted 216
5 SASI_Hs01_00118003 predicted 432
6 SASI_Hs01_00118004 predicted 442
7 SASI_Hs01_00118005 predicted 292
8 SASI_Hs01_00118006 predicted 299
9 SASI_Hs01_00118007 predicted 268
10 SASI_Hs02_00363204 predicted 375
11 SASI_Hs01_00117998 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063400 predicted 286
2 SASI_Rn01_00063401 predicted 487
3 SASI_Rn01_00063402 predicted 479
4 SASI_Rn01_00063403 predicted 677
5 SASI_Rn01_00063405 predicted 218
6 SASI_Rn02_00268797 predicted 841
7 SASI_Rn01_00063406 predicted 383
8 SASI_Rn01_00063407 predicted 210
9 SASI_Rn02_00268798 predicted 308
10 SASI_Rn01_00063408 predicted 965
11 SASI_Rn01_00063404 predicted 326
12 SASI_Rn01_00063409 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121540 predicted 1495
2 SASI_Mm01_00121541 predicted 647
3 SASI_Mm01_00121542 predicted 1044
4 SASI_Mm01_00121543 predicted 1373
5 SASI_Mm01_00121544 predicted 393
6 SASI_Mm01_00121545 predicted 1401
7 SASI_Mm01_00121546 predicted 1301
8 SASI_Mm01_00121547 predicted 380
9 SASI_Mm01_00121548 predicted 486
10 SASI_Mm01_00121549 predicted 695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004180
VALIDATED
TANK MISSION shRNA Bacterial Glycerol Stock
TRAF family member-associated NFKB activator
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004180.2-1289s21c1
Sequence:CCGGCAGTGACTCGGTGGTACTAAGCTCGAGCTTAGTACCACCGAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004180.2-696s21c1
Sequence:CCGGCCTATACAGTGTACGGATAAACTCGAGTTTATCCGTACACTGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004180.2-1144s21c1
Sequence:CCGGTGCCACCTGGAGACCATAATGCTCGAGCATTATGGTCTCCAGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004180.2-1872s21c1
Sequence:CCGGTTTATGCTATAGGTGATATTCCTCGAGGAATATCACCTATAGCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004180.2-357s21c1
Sequence:CCGGTCCACTCAAGATAACAATTATCTCGAGATAATTGTTATCTTGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-1921s1c1
Sequence:CCGGGCAGACAACATAAACATCTTTCTCGAGAAAGATGTTTATGTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-299s1c1
Sequence:CCGGGCTGTCACTTCAACAGACTATCTCGAGATAGTCTGTTGAAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-696s1c1
Sequence:CCGGCCTATACAGTGTACGGATAAACTCGAGTTTATCCGTACACTGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-695s1c1
Sequence:CCGGGCCTATACAGTGTACGGATAACTCGAGTTATCCGTACACTGTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-541s1c1
Sequence:CCGGGCAGTCCTTTGCTCCATGAAACTCGAGTTTCATGGAGCAAAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004180
VALIDATED
TANK MISSION shRNA shRNA Plasmid DNA
TRAF family member-associated NFKB activator
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004180.2-1289s21c1
Sequence:CCGGCAGTGACTCGGTGGTACTAAGCTCGAGCTTAGTACCACCGAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004180.2-696s21c1
Sequence:CCGGCCTATACAGTGTACGGATAAACTCGAGTTTATCCGTACACTGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004180.2-1144s21c1
Sequence:CCGGTGCCACCTGGAGACCATAATGCTCGAGCATTATGGTCTCCAGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004180.2-1872s21c1
Sequence:CCGGTTTATGCTATAGGTGATATTCCTCGAGGAATATCACCTATAGCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004180.2-357s21c1
Sequence:CCGGTCCACTCAAGATAACAATTATCTCGAGATAATTGTTATCTTGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-1921s1c1
Sequence:CCGGGCAGACAACATAAACATCTTTCTCGAGAAAGATGTTTATGTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-299s1c1
Sequence:CCGGGCTGTCACTTCAACAGACTATCTCGAGATAGTCTGTTGAAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-696s1c1
Sequence:CCGGCCTATACAGTGTACGGATAAACTCGAGTTTATCCGTACACTGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-695s1c1
Sequence:CCGGGCCTATACAGTGTACGGATAACTCGAGTTATCCGTACACTGTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-541s1c1
Sequence:CCGGGCAGTCCTTTGCTCCATGAAACTCGAGTTTCATGGAGCAAAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004180
VALIDATED
TANK MISSION shRNA Lentiviral Transduction Particles
TRAF family member-associated NFKB activator
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004180.2-1289s21c1
Sequence:CCGGCAGTGACTCGGTGGTACTAAGCTCGAGCTTAGTACCACCGAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004180.2-696s21c1
Sequence:CCGGCCTATACAGTGTACGGATAAACTCGAGTTTATCCGTACACTGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004180.2-1144s21c1
Sequence:CCGGTGCCACCTGGAGACCATAATGCTCGAGCATTATGGTCTCCAGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004180.2-1872s21c1
Sequence:CCGGTTTATGCTATAGGTGATATTCCTCGAGGAATATCACCTATAGCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004180.2-357s21c1
Sequence:CCGGTCCACTCAAGATAACAATTATCTCGAGATAATTGTTATCTTGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-1921s1c1
Sequence:CCGGGCAGACAACATAAACATCTTTCTCGAGAAAGATGTTTATGTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-299s1c1
Sequence:CCGGGCTGTCACTTCAACAGACTATCTCGAGATAGTCTGTTGAAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-696s1c1
Sequence:CCGGCCTATACAGTGTACGGATAAACTCGAGTTTATCCGTACACTGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-695s1c1
Sequence:CCGGGCCTATACAGTGTACGGATAACTCGAGTTATCCGTACACTGTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004180.2-541s1c1
Sequence:CCGGGCAGTCCTTTGCTCCATGAAACTCGAGTTTCATGGAGCAAAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011529
VALIDATED
TANK MISSION shRNA Bacterial Glycerol Stock
TRAF family member-associated NFKB activator
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011529.1-560s21c1
Sequence:CCGGGCATCACGAAAGGGATAATATCTCGAGATATTATCCCTTTCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011529.1-1792s21c1
Sequence:CCGGCGTACAGAGAATAACAGACAACTCGAGTTGTCTGTTATTCTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011529.1-754s21c1
Sequence:CCGGCCCAGGCTAAAGATGATATAACTCGAGTTATATCATCTTTAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011529.1-1380s21c1
Sequence:CCGGCGGCATCTTAATACACACTTTCTCGAGAAAGTGTGTATTAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011529.1-1792s1c1
Sequence:CCGGCGTACAGAGAATAACAGACAACTCGAGTTGTCTGTTATTCTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011529.1-560s1c1
Sequence:CCGGGCATCACGAAAGGGATAATATCTCGAGATATTATCCCTTTCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011529.1-1380s1c1
Sequence:CCGGCGGCATCTTAATACACACTTTCTCGAGAAAGTGTGTATTAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011529.1-136s1c1
Sequence:CCGGCCATCCTTTATAGTGATGCTACTCGAGTAGCATCACTATAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011529.1-754s1c1
Sequence:CCGGCCCAGGCTAAAGATGATATAACTCGAGTTATATCATCTTTAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011529
VALIDATED
TANK MISSION shRNA shRNA Plasmid DNA
TRAF family member-associated NFKB activator
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011529.1-560s21c1
Sequence:CCGGGCATCACGAAAGGGATAATATCTCGAGATATTATCCCTTTCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011529.1-1792s21c1
Sequence:CCGGCGTACAGAGAATAACAGACAACTCGAGTTGTCTGTTATTCTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011529.1-754s21c1
Sequence:CCGGCCCAGGCTAAAGATGATATAACTCGAGTTATATCATCTTTAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011529.1-1380s21c1
Sequence:CCGGCGGCATCTTAATACACACTTTCTCGAGAAAGTGTGTATTAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011529.1-1792s1c1
Sequence:CCGGCGTACAGAGAATAACAGACAACTCGAGTTGTCTGTTATTCTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011529.1-560s1c1
Sequence:CCGGGCATCACGAAAGGGATAATATCTCGAGATATTATCCCTTTCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011529.1-1380s1c1
Sequence:CCGGCGGCATCTTAATACACACTTTCTCGAGAAAGTGTGTATTAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011529.1-136s1c1
Sequence:CCGGCCATCCTTTATAGTGATGCTACTCGAGTAGCATCACTATAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011529.1-754s1c1
Sequence:CCGGCCCAGGCTAAAGATGATATAACTCGAGTTATATCATCTTTAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011529
VALIDATED
TANK MISSION shRNA Lentiviral Transduction Particles
TRAF family member-associated NFKB activator
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011529.1-560s21c1
Sequence:CCGGGCATCACGAAAGGGATAATATCTCGAGATATTATCCCTTTCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011529.1-1792s21c1
Sequence:CCGGCGTACAGAGAATAACAGACAACTCGAGTTGTCTGTTATTCTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011529.1-754s21c1
Sequence:CCGGCCCAGGCTAAAGATGATATAACTCGAGTTATATCATCTTTAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011529.1-1380s21c1
Sequence:CCGGCGGCATCTTAATACACACTTTCTCGAGAAAGTGTGTATTAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011529.1-1792s1c1
Sequence:CCGGCGTACAGAGAATAACAGACAACTCGAGTTGTCTGTTATTCTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011529.1-560s1c1
Sequence:CCGGGCATCACGAAAGGGATAATATCTCGAGATATTATCCCTTTCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011529.1-1380s1c1
Sequence:CCGGCGGCATCTTAATACACACTTTCTCGAGAAAGTGTGTATTAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011529.1-136s1c1
Sequence:CCGGCCATCCTTTATAGTGATGCTACTCGAGTAGCATCACTATAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011529.1-754s1c1
Sequence:CCGGCCCAGGCTAAAGATGATATAACTCGAGTTATATCATCTTTAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks