EMAIL THIS PAGE TO A FRIEND

TAOK1

TAO kinase 1

Synonyms: KFC-B MAP3K16 MARKK PSK-2 PSK2 TAO1 hKFC-B hTAOK1
Gene ID:
Mouse(216965) TAO kinase 1
Rat(286993) TAO kinase 1
chicken(417583) TAO kinase 1
dog(480632) TAO kinase 1
Horse(100059705) TAO kinase 1
cow(536532) TAO kinase 1
sheep(101109719) TAO kinase 1
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020791 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_484053 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484053 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484053 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020791 siRNAs that have been validated in the lab human pricing
NM_173327 Rosetta Predictions rat pricing
NM_144825 Rosetta Predictions mouse pricing
XM_484053 Rosetta Predictions mouse pricing
XM_895070 Rosetta Predictions mouse pricing
XM_902531 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020791 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115006 validated 1859
2 SASI_Hs02_00353947 predicted 2342
3 SASI_Hs02_00353948 predicted 1881
4 SASI_Hs01_00115008 predicted 1187
5 SASI_Hs01_00115011 predicted 1502
6 SASI_Hs02_00353949 predicted 2034
7 SASI_Hs02_00353950 predicted 2089
8 SASI_Hs01_00115013 predicted 2055
9 SASI_Hs01_00115014 predicted 2828
10 SASI_Hs02_00353951 predicted 2764
11 SASI_Hs01_00115007 predicted 610
12 SASI_Hs01_00115009 predicted 2329
13 SASI_Hs01_00115010 predicted 2513
14 SASI_Hs01_00115012 predicted 1373
15 SASI_Hs01_00115015 predicted 1681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093440 predicted 2244
2 SASI_Rn01_00093442 predicted 817
3 SASI_Rn01_00093443 predicted 2433
4 SASI_Rn02_00269446 predicted 1494
5 SASI_Rn02_00269447 predicted 315
6 SASI_Rn02_00269448 predicted 1005
7 SASI_Rn01_00093445 predicted 1749
8 SASI_Rn01_00093447 predicted 1186
9 SASI_Rn01_00093448 predicted 1278
10 SASI_Rn02_00269449 predicted 1398
11 SASI_Rn01_00093439 predicted 2655
12 SASI_Rn01_00093441 predicted 1414
13 SASI_Rn01_00093444 predicted 1214
14 SASI_Rn01_00093446 predicted 2070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340200 predicted 1744
2 SASI_Mm02_00340201 predicted 1656
3 SASI_Mm02_00340202 predicted 3008
4 SASI_Mm02_00340203 predicted 2757
5 SASI_Mm02_00340204 predicted 3262
6 SASI_Mm02_00340205 predicted 1583
7 SASI_Mm02_00340206 predicted 1854
8 SASI_Mm02_00340207 predicted 2179
9 SASI_Mm02_00340208 predicted 2190
10 SASI_Mm02_00340209 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262493 predicted 3284
2 SASI_Mm01_00262494 predicted 3573
3 SASI_Mm01_00262495 predicted 2986
4 SASI_Mm01_00262496 predicted 3239
5 SASI_Mm01_00262497 predicted 2570
6 SASI_Mm01_00262498 predicted 3388
7 SASI_Mm01_00262499 predicted 2874
8 SASI_Mm01_00262500 predicted 2201
9 SASI_Mm01_00262501 predicted 2653
10 SASI_Mm01_00262502 predicted 3302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269754 predicted 3316
2 SASI_Mm01_00269755 predicted 3597
3 SASI_Mm01_00269756 predicted 3019
4 SASI_Mm01_00269757 predicted 3265
5 SASI_Mm01_00269758 predicted 2592
6 SASI_Mm01_00269759 predicted 3417
7 SASI_Mm01_00269760 predicted 2904
8 SASI_Mm01_00269761 predicted 2229
9 SASI_Mm01_00269762 predicted 2680
10 SASI_Mm01_00269763 predicted 3336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268645 predicted 2171
2 SASI_Mm01_00268646 predicted 2450
3 SASI_Mm01_00268647 predicted 1877
4 SASI_Mm01_00268648 predicted 2129
5 SASI_Mm01_00268649 predicted 1445
6 SASI_Mm01_00268650 predicted 2269
7 SASI_Mm01_00268651 predicted 1763
8 SASI_Mm01_00268652 predicted 1081
9 SASI_Mm01_00268653 predicted 1535
10 SASI_Mm01_00268654 predicted 2194
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020791
VALIDATED
TAOK1 MISSION shRNA Bacterial Glycerol Stock
TAO kinase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020791.1-1462s1c1
Sequence:CCGGCCCAAGTATCTCGTCACAAATCTCGAGATTTGTGACGAGATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020791.1-1671s1c1
Sequence:CCGGCGCCTCAGATTAGACAAAGATCTCGAGATCTTTGTCTAATCTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020791.1-3151s1c1
Sequence:CCGGCGAGTGTCACTTCACAAATATCTCGAGATATTTGTGAAGTGACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020791.1-2327s1c1
Sequence:CCGGGCCTAAGAGTTTGAAGTCTAACTCGAGTTAGACTTCAAACTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020791.1-1886s1c1
Sequence:CCGGGCAGCTTAAAGAGGAGCTAAACTCGAGTTTAGCTCCTCTTTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020791.1-932s1c1
Sequence:CCGGGTCTAATGAATGGTCTGATTACTCGAGTAATCAGACCATTCATTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020791.1-1497s1c1
Sequence:CCGGCGAGAACACTTTGCTACTATACTCGAGTATAGTAGCAAAGTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020791.1-3304s1c1
Sequence:CCGGGCTGAGTGCATATGGTATATTCTCGAGAATATACCATATGCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020791.1-2327s21c1
Sequence:CCGGGCCTAAGAGTTTGAAGTCTAACTCGAGTTAGACTTCAAACTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020791.1-3151s21c1
Sequence:CCGGCGAGTGTCACTTCACAAATATCTCGAGATATTTGTGAAGTGACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020791.1-450s21c1
Sequence:CCGGCCCAACAGTATAGAATACAAACTCGAGTTTGTATTCTATACTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020791.1-1462s21c1
Sequence:CCGGCCCAAGTATCTCGTCACAAATCTCGAGATTTGTGACGAGATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020791
VALIDATED
TAOK1 MISSION shRNA shRNA Plasmid DNA
TAO kinase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020791.1-1462s1c1
Sequence:CCGGCCCAAGTATCTCGTCACAAATCTCGAGATTTGTGACGAGATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020791.1-1671s1c1
Sequence:CCGGCGCCTCAGATTAGACAAAGATCTCGAGATCTTTGTCTAATCTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020791.1-3151s1c1
Sequence:CCGGCGAGTGTCACTTCACAAATATCTCGAGATATTTGTGAAGTGACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020791.1-2327s1c1
Sequence:CCGGGCCTAAGAGTTTGAAGTCTAACTCGAGTTAGACTTCAAACTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020791.1-1886s1c1
Sequence:CCGGGCAGCTTAAAGAGGAGCTAAACTCGAGTTTAGCTCCTCTTTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020791.1-932s1c1
Sequence:CCGGGTCTAATGAATGGTCTGATTACTCGAGTAATCAGACCATTCATTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020791.1-1497s1c1
Sequence:CCGGCGAGAACACTTTGCTACTATACTCGAGTATAGTAGCAAAGTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020791.1-3304s1c1
Sequence:CCGGGCTGAGTGCATATGGTATATTCTCGAGAATATACCATATGCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020791.1-2327s21c1
Sequence:CCGGGCCTAAGAGTTTGAAGTCTAACTCGAGTTAGACTTCAAACTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020791.1-3151s21c1
Sequence:CCGGCGAGTGTCACTTCACAAATATCTCGAGATATTTGTGAAGTGACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020791.1-450s21c1
Sequence:CCGGCCCAACAGTATAGAATACAAACTCGAGTTTGTATTCTATACTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020791.1-1462s21c1
Sequence:CCGGCCCAAGTATCTCGTCACAAATCTCGAGATTTGTGACGAGATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020791
VALIDATED
TAOK1 MISSION shRNA Lentiviral Transduction Particles
TAO kinase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020791.1-1462s1c1
Sequence:CCGGCCCAAGTATCTCGTCACAAATCTCGAGATTTGTGACGAGATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020791.1-1671s1c1
Sequence:CCGGCGCCTCAGATTAGACAAAGATCTCGAGATCTTTGTCTAATCTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020791.1-3151s1c1
Sequence:CCGGCGAGTGTCACTTCACAAATATCTCGAGATATTTGTGAAGTGACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020791.1-2327s1c1
Sequence:CCGGGCCTAAGAGTTTGAAGTCTAACTCGAGTTAGACTTCAAACTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020791.1-1886s1c1
Sequence:CCGGGCAGCTTAAAGAGGAGCTAAACTCGAGTTTAGCTCCTCTTTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020791.1-932s1c1
Sequence:CCGGGTCTAATGAATGGTCTGATTACTCGAGTAATCAGACCATTCATTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020791.1-1497s1c1
Sequence:CCGGCGAGAACACTTTGCTACTATACTCGAGTATAGTAGCAAAGTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020791.1-3304s1c1
Sequence:CCGGGCTGAGTGCATATGGTATATTCTCGAGAATATACCATATGCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020791.1-2327s21c1
Sequence:CCGGGCCTAAGAGTTTGAAGTCTAACTCGAGTTAGACTTCAAACTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020791.1-3151s21c1
Sequence:CCGGCGAGTGTCACTTCACAAATATCTCGAGATATTTGTGAAGTGACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020791.1-450s21c1
Sequence:CCGGCCCAACAGTATAGAATACAAACTCGAGTTTGTATTCTATACTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020791.1-1462s21c1
Sequence:CCGGCCCAAGTATCTCGTCACAAATCTCGAGATTTGTGACGAGATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484053
VALIDATED
TAOK1 MISSION shRNA Bacterial Glycerol Stock
TAO kinase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484053.2-6491s1c1
Sequence:CCGGGCCATTTACAAGTGGAAATAACTCGAGTTATTTCCACTTGTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_484053.2-897s1c1
Sequence:CCGGGCGCCCTGAAACAGTGTTAATCTCGAGATTAACACTGTTTCAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_484053.2-2040s1c1
Sequence:CCGGCCATCTCAACACTATTCAGAACTCGAGTTCTGAATAGTGTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_484053.2-2337s1c1
Sequence:CCGGGACTCGAAAGTTAGCCATCTTCTCGAGAAGATGGCTAACTTTCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_484053.2-1522s1c1
Sequence:CCGGCGGCTCAGATTAGACAAAGATCTCGAGATCTTTGTCTAATCTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484053
VALIDATED
TAOK1 MISSION shRNA shRNA Plasmid DNA
TAO kinase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484053.2-6491s1c1
Sequence:CCGGGCCATTTACAAGTGGAAATAACTCGAGTTATTTCCACTTGTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_484053.2-897s1c1
Sequence:CCGGGCGCCCTGAAACAGTGTTAATCTCGAGATTAACACTGTTTCAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_484053.2-2040s1c1
Sequence:CCGGCCATCTCAACACTATTCAGAACTCGAGTTCTGAATAGTGTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_484053.2-2337s1c1
Sequence:CCGGGACTCGAAAGTTAGCCATCTTCTCGAGAAGATGGCTAACTTTCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_484053.2-1522s1c1
Sequence:CCGGCGGCTCAGATTAGACAAAGATCTCGAGATCTTTGTCTAATCTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484053
VALIDATED
TAOK1 MISSION shRNA Lentiviral Transduction Particles
TAO kinase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484053.2-6491s1c1
Sequence:CCGGGCCATTTACAAGTGGAAATAACTCGAGTTATTTCCACTTGTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_484053.2-897s1c1
Sequence:CCGGGCGCCCTGAAACAGTGTTAATCTCGAGATTAACACTGTTTCAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_484053.2-2040s1c1
Sequence:CCGGCCATCTCAACACTATTCAGAACTCGAGTTCTGAATAGTGTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_484053.2-2337s1c1
Sequence:CCGGGACTCGAAAGTTAGCCATCTTCTCGAGAAGATGGCTAACTTTCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_484053.2-1522s1c1
Sequence:CCGGCGGCTCAGATTAGACAAAGATCTCGAGATCTTTGTCTAATCTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144825
VALIDATED
TAOK1 MISSION shRNA Bacterial Glycerol Stock
TAO kinase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144825.2-831s21c1
Sequence:CCGGGCACGAGATGTGCGTACTAATCTCGAGATTAGTACGCACATCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144825.2-2990s21c1
Sequence:CCGGGACTCGAAAGTTAGCCATCTTCTCGAGAAGATGGCTAACTTTCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144825.2-1550s21c1
Sequence:CCGGGCGCCCTGAAACAGTGTTAATCTCGAGATTAACACTGTTTCAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144825.2-3859s21c1
Sequence:CCGGTAATTGGGATGTCATAGTATTCTCGAGAATACTATGACATCCCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144825.2-1981s21c1
Sequence:CCGGACAAGTCACATTATCGTAATACTCGAGTATTACGATAATGTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144825
VALIDATED
TAOK1 MISSION shRNA shRNA Plasmid DNA
TAO kinase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144825.2-831s21c1
Sequence:CCGGGCACGAGATGTGCGTACTAATCTCGAGATTAGTACGCACATCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144825.2-2990s21c1
Sequence:CCGGGACTCGAAAGTTAGCCATCTTCTCGAGAAGATGGCTAACTTTCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144825.2-1550s21c1
Sequence:CCGGGCGCCCTGAAACAGTGTTAATCTCGAGATTAACACTGTTTCAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144825.2-3859s21c1
Sequence:CCGGTAATTGGGATGTCATAGTATTCTCGAGAATACTATGACATCCCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144825.2-1981s21c1
Sequence:CCGGACAAGTCACATTATCGTAATACTCGAGTATTACGATAATGTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144825
VALIDATED
TAOK1 MISSION shRNA Lentiviral Transduction Particles
TAO kinase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144825.2-831s21c1
Sequence:CCGGGCACGAGATGTGCGTACTAATCTCGAGATTAGTACGCACATCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144825.2-2990s21c1
Sequence:CCGGGACTCGAAAGTTAGCCATCTTCTCGAGAAGATGGCTAACTTTCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144825.2-1550s21c1
Sequence:CCGGGCGCCCTGAAACAGTGTTAATCTCGAGATTAACACTGTTTCAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144825.2-3859s21c1
Sequence:CCGGTAATTGGGATGTCATAGTATTCTCGAGAATACTATGACATCCCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144825.2-1981s21c1
Sequence:CCGGACAAGTCACATTATCGTAATACTCGAGTATTACGATAATGTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks