EMAIL THIS PAGE TO A FRIEND

TAOK2

TAO kinase 2

Synonyms: MAP3K17 PSK PSK1 PSK1-BETA TAO1 TAO2
Gene ID:
Human(9344) Summary: This gene encodes a serine/threonine protein kinase that is involved in many different processes, including, cell signaling, microtubule organization and stability, and apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Mouse(381921) TAO kinase 2
Rat(64666) TAO kinase 2
cow(533897) TAO kinase 2
sheep(101117721) TAO kinase 2
dog(489943) TAO kinase 2
Horse(100066000) TAO kinase 2
Gene Class: Cytoskeleton
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016151 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_004783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004783 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355941 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355941 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355941 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004783 Rosetta Predictions human pricing
NM_016151 Rosetta Predictions human pricing
NM_022702 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014504 predicted 1467
2 SASI_Hs01_00014505 predicted 1282
3 SASI_Hs01_00014506 predicted 1253
4 SASI_Hs02_00338295 predicted 1531
5 SASI_Hs01_00014507 predicted 941
6 SASI_Hs01_00014508 predicted 2704
7 SASI_Hs02_00338296 predicted 1454
8 SASI_Hs01_00014509 predicted 814
9 SASI_Hs01_00014510 predicted 1577
10 SASI_Hs01_00014512 predicted 893
11 SASI_Hs01_00014503 predicted 1449
12 SASI_Hs01_00014511 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149801 predicted 1464
2 SASI_Hs01_00149802 predicted 1285
3 SASI_Hs01_00149803 predicted 1255
4 SASI_Hs02_00348953 predicted 1526
5 SASI_Hs01_00149804 predicted 945
6 SASI_Hs01_00149805 predicted 2708
7 SASI_Hs02_00348954 predicted 1448
8 SASI_Hs01_00149806 predicted 812
9 SASI_Hs01_00149807 predicted 1581
10 SASI_Hs01_00149809 predicted 889
11 SASI_Hs01_00149800 predicted 1449
12 SASI_Hs01_00149808 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066157 predicted 880
2 SASI_Rn01_00066158 predicted 426
3 SASI_Rn01_00066159 predicted 354
4 SASI_Rn02_00263508 predicted 3932
5 SASI_Rn01_00066160 predicted 3899
6 SASI_Rn01_00066162 predicted 3592
7 SASI_Rn01_00066163 predicted 462
8 SASI_Rn01_00066164 predicted 284
9 SASI_Rn01_00066165 predicted 1947
10 SASI_Rn01_00066166 predicted 3690
11 SASI_Rn01_00066161 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016151
TAOK2 MISSION shRNA Bacterial Glycerol Stock
TAO kinase 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016151.2-4541s21c1
Sequence:CCGGCCCACGACTCAGTGAAGTTTCCTCGAGGAAACTTCACTGAGTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016151.x-4493s1c1
Sequence:CCGGCTAGAGCATTGAGCACTTTATCTCGAGATAAAGTGCTCAATGCTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016151.x-1425s1c1
Sequence:CCGGCCACCGCTCTTTAACATGAATCTCGAGATTCATGTTAAAGAGCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016151.x-1985s1c1
Sequence:CCGGCACCTCTCACAGCTCCATTATCTCGAGATAATGGAGCTGTGAGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016151.x-1186s1c1
Sequence:CCGGACTCCCACAACATGATCCATACTCGAGTATGGATCATGTTGTGGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016151.x-1059s1c1
Sequence:CCGGGCTTGGCTGGTAATGGAGTATCTCGAGATACTCCATTACCAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016151
TAOK2 MISSION shRNA shRNA Plasmid DNA
TAO kinase 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016151.2-4541s21c1
Sequence:CCGGCCCACGACTCAGTGAAGTTTCCTCGAGGAAACTTCACTGAGTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016151.x-4493s1c1
Sequence:CCGGCTAGAGCATTGAGCACTTTATCTCGAGATAAAGTGCTCAATGCTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016151.x-1425s1c1
Sequence:CCGGCCACCGCTCTTTAACATGAATCTCGAGATTCATGTTAAAGAGCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016151.x-1985s1c1
Sequence:CCGGCACCTCTCACAGCTCCATTATCTCGAGATAATGGAGCTGTGAGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016151.x-1186s1c1
Sequence:CCGGACTCCCACAACATGATCCATACTCGAGTATGGATCATGTTGTGGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016151.x-1059s1c1
Sequence:CCGGGCTTGGCTGGTAATGGAGTATCTCGAGATACTCCATTACCAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016151
TAOK2 MISSION shRNA Lentiviral Transduction Particles
TAO kinase 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016151.2-4541s21c1
Sequence:CCGGCCCACGACTCAGTGAAGTTTCCTCGAGGAAACTTCACTGAGTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016151.x-4493s1c1
Sequence:CCGGCTAGAGCATTGAGCACTTTATCTCGAGATAAAGTGCTCAATGCTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016151.x-1425s1c1
Sequence:CCGGCCACCGCTCTTTAACATGAATCTCGAGATTCATGTTAAAGAGCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016151.x-1985s1c1
Sequence:CCGGCACCTCTCACAGCTCCATTATCTCGAGATAATGGAGCTGTGAGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016151.x-1186s1c1
Sequence:CCGGACTCCCACAACATGATCCATACTCGAGTATGGATCATGTTGTGGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016151.x-1059s1c1
Sequence:CCGGGCTTGGCTGGTAATGGAGTATCTCGAGATACTCCATTACCAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004783
VALIDATED
TAOK2 MISSION shRNA Bacterial Glycerol Stock
TAO kinase 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004783.2-1443s21c1
Sequence:CCGGACGGAAACCACCGCTCTTTAACTCGAGTTAAAGAGCGGTGGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004783.2-1533s21c1
Sequence:CCGGGTCTGAGTACTTCCGGAATTTCTCGAGAAATTCCGGAAGTACTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004783.2-2041s21c1
Sequence:CCGGCCGGGCTCTGACAACCTATATCTCGAGATATAGGTTGTCAGAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004783.2-4246s21c1
Sequence:CCGGTGGGTCTAGACATACTATATTCTCGAGAATATAGTATGTCTAGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004783.2-865s21c1
Sequence:CCGGTTCTCTGACCTCCGGGAAATTCTCGAGAATTTCCCGGAGGTCAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004783.1-3728s1c1
Sequence:CCGGGCTTGGCGATAGATGCCTCAACTCGAGTTGAGGCATCTATCGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.1-745s1c1
Sequence:CCGGCCTTCTAGAAGTGCACAAGAACTCGAGTTCTTGTGCACTTCTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004783.1-567s1c1
Sequence:CCGGCCATCAAGAAGATGTCCTACACTCGAGTGTAGGACATCTTCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.1-3386s1c1
Sequence:CCGGGCCCTGCTGCTGCTAAGAAACCTCGAGGTTTCTTAGCAGCAGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004783.1-3817s1c1
Sequence:CCGGGAGATGTGCGTGTCAAATATTCTCGAGAATATTTGACACGCACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-1630s1c1
Sequence:CCGGCACCTCTCACAGCTCCATTATCTCGAGATAATGGAGCTGTGAGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-704s1c1
Sequence:CCGGGCTTGGCTGGTAATGGAGTATCTCGAGATACTCCATTACCAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-1070s1c1
Sequence:CCGGCCACCGCTCTTTAACATGAATCTCGAGATTCATGTTAAAGAGCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-831s1c1
Sequence:CCGGACTCCCACAACATGATCCATACTCGAGTATGGATCATGTTGTGGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-1106s1c1
Sequence:CCGGTACCACATTGCACAGAACGAACTCGAGTTCGTTCTGTGCAATGTGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004783
VALIDATED
TAOK2 MISSION shRNA shRNA Plasmid DNA
TAO kinase 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004783.2-1443s21c1
Sequence:CCGGACGGAAACCACCGCTCTTTAACTCGAGTTAAAGAGCGGTGGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004783.2-1533s21c1
Sequence:CCGGGTCTGAGTACTTCCGGAATTTCTCGAGAAATTCCGGAAGTACTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004783.2-2041s21c1
Sequence:CCGGCCGGGCTCTGACAACCTATATCTCGAGATATAGGTTGTCAGAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004783.2-4246s21c1
Sequence:CCGGTGGGTCTAGACATACTATATTCTCGAGAATATAGTATGTCTAGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004783.2-865s21c1
Sequence:CCGGTTCTCTGACCTCCGGGAAATTCTCGAGAATTTCCCGGAGGTCAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004783.1-3728s1c1
Sequence:CCGGGCTTGGCGATAGATGCCTCAACTCGAGTTGAGGCATCTATCGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.1-745s1c1
Sequence:CCGGCCTTCTAGAAGTGCACAAGAACTCGAGTTCTTGTGCACTTCTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004783.1-567s1c1
Sequence:CCGGCCATCAAGAAGATGTCCTACACTCGAGTGTAGGACATCTTCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.1-3386s1c1
Sequence:CCGGGCCCTGCTGCTGCTAAGAAACCTCGAGGTTTCTTAGCAGCAGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004783.1-3817s1c1
Sequence:CCGGGAGATGTGCGTGTCAAATATTCTCGAGAATATTTGACACGCACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-1630s1c1
Sequence:CCGGCACCTCTCACAGCTCCATTATCTCGAGATAATGGAGCTGTGAGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-704s1c1
Sequence:CCGGGCTTGGCTGGTAATGGAGTATCTCGAGATACTCCATTACCAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-1070s1c1
Sequence:CCGGCCACCGCTCTTTAACATGAATCTCGAGATTCATGTTAAAGAGCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-831s1c1
Sequence:CCGGACTCCCACAACATGATCCATACTCGAGTATGGATCATGTTGTGGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-1106s1c1
Sequence:CCGGTACCACATTGCACAGAACGAACTCGAGTTCGTTCTGTGCAATGTGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004783
VALIDATED
TAOK2 MISSION shRNA Lentiviral Transduction Particles
TAO kinase 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004783.2-1443s21c1
Sequence:CCGGACGGAAACCACCGCTCTTTAACTCGAGTTAAAGAGCGGTGGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004783.2-1533s21c1
Sequence:CCGGGTCTGAGTACTTCCGGAATTTCTCGAGAAATTCCGGAAGTACTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004783.2-2041s21c1
Sequence:CCGGCCGGGCTCTGACAACCTATATCTCGAGATATAGGTTGTCAGAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004783.2-4246s21c1
Sequence:CCGGTGGGTCTAGACATACTATATTCTCGAGAATATAGTATGTCTAGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004783.2-865s21c1
Sequence:CCGGTTCTCTGACCTCCGGGAAATTCTCGAGAATTTCCCGGAGGTCAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004783.1-3728s1c1
Sequence:CCGGGCTTGGCGATAGATGCCTCAACTCGAGTTGAGGCATCTATCGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.1-745s1c1
Sequence:CCGGCCTTCTAGAAGTGCACAAGAACTCGAGTTCTTGTGCACTTCTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004783.1-567s1c1
Sequence:CCGGCCATCAAGAAGATGTCCTACACTCGAGTGTAGGACATCTTCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.1-3386s1c1
Sequence:CCGGGCCCTGCTGCTGCTAAGAAACCTCGAGGTTTCTTAGCAGCAGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004783.1-3817s1c1
Sequence:CCGGGAGATGTGCGTGTCAAATATTCTCGAGAATATTTGACACGCACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-1630s1c1
Sequence:CCGGCACCTCTCACAGCTCCATTATCTCGAGATAATGGAGCTGTGAGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-704s1c1
Sequence:CCGGGCTTGGCTGGTAATGGAGTATCTCGAGATACTCCATTACCAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-1070s1c1
Sequence:CCGGCCACCGCTCTTTAACATGAATCTCGAGATTCATGTTAAAGAGCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-831s1c1
Sequence:CCGGACTCCCACAACATGATCCATACTCGAGTATGGATCATGTTGTGGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004783.x-1106s1c1
Sequence:CCGGTACCACATTGCACAGAACGAACTCGAGTTCGTTCTGTGCAATGTGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355941
TAOK2 MISSION shRNA Bacterial Glycerol Stock
TAO kinase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-252s1c1
Sequence:CCGGGCATCCTAATACCATTCAGTACTCGAGTACTGAATGGTATTAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-2008s1c1
Sequence:CCGGCGAGAGGACTTGAATAAGAAACTCGAGTTTCTTATTCAAGTCCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-3374s1c1
Sequence:CCGGCCAATAAGAATGGTTTCCGAACTCGAGTTCGGAAACCATTCTTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-586s1c1
Sequence:CCGGGCCATGGATGAGGGACAATATCTCGAGATATTGTCCCTCATCCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-1408s1c1
Sequence:CCGGCGAGACCACTTTGCTACCATTCTCGAGAATGGTAGCAAAGTGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355941
TAOK2 MISSION shRNA shRNA Plasmid DNA
TAO kinase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-252s1c1
Sequence:CCGGGCATCCTAATACCATTCAGTACTCGAGTACTGAATGGTATTAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-2008s1c1
Sequence:CCGGCGAGAGGACTTGAATAAGAAACTCGAGTTTCTTATTCAAGTCCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-3374s1c1
Sequence:CCGGCCAATAAGAATGGTTTCCGAACTCGAGTTCGGAAACCATTCTTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-586s1c1
Sequence:CCGGGCCATGGATGAGGGACAATATCTCGAGATATTGTCCCTCATCCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-1408s1c1
Sequence:CCGGCGAGACCACTTTGCTACCATTCTCGAGAATGGTAGCAAAGTGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355941
TAOK2 MISSION shRNA Lentiviral Transduction Particles
TAO kinase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-252s1c1
Sequence:CCGGGCATCCTAATACCATTCAGTACTCGAGTACTGAATGGTATTAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-2008s1c1
Sequence:CCGGCGAGAGGACTTGAATAAGAAACTCGAGTTTCTTATTCAAGTCCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-3374s1c1
Sequence:CCGGCCAATAAGAATGGTTTCCGAACTCGAGTTCGGAAACCATTCTTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-586s1c1
Sequence:CCGGGCCATGGATGAGGGACAATATCTCGAGATATTGTCCCTCATCCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355941.1-1408s1c1
Sequence:CCGGCGAGACCACTTTGCTACCATTCTCGAGAATGGTAGCAAAGTGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks