EMAIL THIS PAGE TO A FRIEND

TAOK3

TAO kinase 3

Synonyms: DPK JIK MAP3K18
UniProtKB ID: Q9H2K8, Q658N1, Q8IUM4, Q9HC79, Q9NZM9, Q9UHG7
Gene ID:
Mouse(330177) TAO kinase 3
Rat(304530) TAO kinase 3
chicken(395499) TAO kinase 3
Horse(100050932) TAO kinase 3
dog(477502) TAO kinase 3
cow(534620) TAO kinase 3
sheep(101108689) TAO kinase 3
236 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306347 ANTI-JIK (TAOK3)(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2500549 Anti-JIK/TAOK3 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human
ELISA, immunohistochemistry, western blot pricing
SAB1301977 ANTI-MOUSE TAOK3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
T5952 Anti-TAOK3 (446-460) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA017160 Anti-TAOK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0051347M3 Monoclonal Anti-TAOK3 antibody produced in mouse clone 4C12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409413 Monoclonal Anti-TAOK3 antibody produced in mouse clone 3B2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409414 Monoclonal Anti-TAOK3 antibody produced in mouse clone 2B8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409415 Monoclonal Anti-TAOK3 antibody produced in mouse clone 1D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1405092 Monoclonal Anti-TAOK3, (C-terminal) antibody produced in mouse clone 1D2, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081308 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081308 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081308 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016281 siRNAs that have been validated in the lab human pricing
NM_001024254 Rosetta Predictions rat pricing
NM_001081308 Rosetta Predictions mouse pricing
XM_889805 Rosetta Predictions mouse pricing
XM_898640 Rosetta Predictions mouse pricing
XM_898648 Rosetta Predictions mouse pricing
XM_898654 Rosetta Predictions mouse pricing
XM_898662 Rosetta Predictions mouse pricing
XM_898669 Rosetta Predictions mouse pricing
XM_898685 Rosetta Predictions mouse pricing
XM_898693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016281 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034550 validated 2795
2 SASI_Hs01_00034551 predicted 2319
3 SASI_Hs01_00034552 predicted 1808
4 SASI_Hs02_00349194 predicted 2755
5 SASI_Hs01_00034553 predicted 633
6 SASI_Hs01_00034555 predicted 933
7 SASI_Hs02_00349195 predicted 2848
8 SASI_Hs01_00034557 predicted 2118
9 SASI_Hs01_00034559 predicted 897
10 SASI_Hs02_00349196 predicted 725
11 SASI_Hs01_00034554 predicted 1487
12 SASI_Hs01_00034556 predicted 1480
13 SASI_Hs01_00034558 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092794 predicted 535
2 SASI_Rn02_00202414 predicted 1434
3 SASI_Rn01_00092795 predicted 1763
4 SASI_Rn01_00092796 predicted 234
5 SASI_Rn01_00092797 predicted 1110
6 SASI_Rn01_00092798 predicted 559
7 SASI_Rn01_00092799 predicted 770
8 SASI_Rn02_00202415 predicted 440
9 SASI_Rn01_00092800 predicted 2422
10 SASI_Rn01_00092801 predicted 1297
11 SASI_Rn01_00092802 predicted 994
12 SASI_Rn01_00092803 predicted 2284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297161 predicted 690
2 SASI_Mm02_00297162 predicted 1271
3 SASI_Mm02_00297163 predicted 469
4 SASI_Mm02_00297164 predicted 2574
5 SASI_Mm02_00297165 predicted 928
6 SASI_Mm02_00297166 predicted 2158
7 SASI_Mm02_00297167 predicted 717
8 SASI_Mm02_00297168 predicted 534
9 SASI_Mm02_00297169 predicted 2005
10 SASI_Mm02_00297170 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_889805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237858 predicted 700
2 SASI_Mm01_00237859 predicted 1276
3 SASI_Mm01_00237860 predicted 472
4 SASI_Mm01_00237861 predicted 2586
5 SASI_Mm01_00237862 predicted 934
6 SASI_Mm01_00237863 predicted 598
7 SASI_Mm01_00237864 predicted 2164
8 SASI_Mm01_00237865 predicted 725
9 SASI_Mm01_00237866 predicted 2016
10 SASI_Mm01_00237867 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263765 predicted 611
2 SASI_Mm01_00263766 predicted 592
3 SASI_Mm01_00263767 predicted 539
4 SASI_Mm01_00263768 predicted 586
5 SASI_Mm01_00263769 predicted 577
6 SASI_Mm01_00263770 predicted 587
7 SASI_Mm01_00263771 predicted 561
8 SASI_Mm01_00263772 predicted 589
9 SASI_Mm01_00263773 predicted 587
10 SASI_Mm01_00263774 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213118 predicted 796
2 SASI_Mm01_00213119 predicted 1368
3 SASI_Mm01_00213120 predicted 558
4 SASI_Mm01_00213121 predicted 2672
5 SASI_Mm01_00213122 predicted 1029
6 SASI_Mm01_00213123 predicted 690
7 SASI_Mm01_00213124 predicted 2255
8 SASI_Mm01_00213125 predicted 818
9 SASI_Mm01_00213126 predicted 2108
10 SASI_Mm01_00213127 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201974 predicted 3388
2 SASI_Mm01_00201975 predicted 2971
3 SASI_Mm01_00201976 predicted 3291
4 SASI_Mm01_00201977 predicted 3130
5 SASI_Mm01_00201978 predicted 3042
6 SASI_Mm01_00201979 predicted 3128
7 SASI_Mm01_00201980 predicted 3003
8 SASI_Mm01_00201981 predicted 3573
9 SASI_Mm01_00201982 predicted 3065
10 SASI_Mm01_00201983 predicted 3347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252625 predicted 789
2 SASI_Mm01_00252626 predicted 1370
3 SASI_Mm01_00252627 predicted 564
4 SASI_Mm01_00252628 predicted 1029
5 SASI_Mm01_00252629 predicted 691
6 SASI_Mm01_00252630 predicted 672
7 SASI_Mm01_00252631 predicted 812
8 SASI_Mm01_00252632 predicted 631
9 SASI_Mm01_00252633 predicted 788
10 SASI_Mm01_00252634 predicted 1556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278668 predicted 1583
2 SASI_Mm01_00278669 predicted 776
3 SASI_Mm01_00278670 predicted 1549
4 SASI_Mm01_00278671 predicted 1125
5 SASI_Mm01_00278672 predicted 975
6 SASI_Mm01_00278673 predicted 979
7 SASI_Mm01_00278674 predicted 1062
8 SASI_Mm01_00278675 predicted 1416
9 SASI_Mm01_00278676 predicted 800
10 SASI_Mm01_00278677 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268625 predicted 803
2 SASI_Mm01_00268626 predicted 1385
3 SASI_Mm01_00268627 predicted 575
4 SASI_Mm01_00268628 predicted 2686
5 SASI_Mm01_00268629 predicted 1044
6 SASI_Mm01_00268630 predicted 704
7 SASI_Mm01_00268631 predicted 2261
8 SASI_Mm01_00268632 predicted 830
9 SASI_Mm01_00268633 predicted 2125
10 SASI_Mm01_00268634 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268635 predicted 813
2 SASI_Mm01_00268636 predicted 1383
3 SASI_Mm01_00268637 predicted 582
4 SASI_Mm01_00268638 predicted 2702
5 SASI_Mm01_00268639 predicted 1049
6 SASI_Mm01_00268640 predicted 719
7 SASI_Mm01_00268641 predicted 2278
8 SASI_Mm01_00268642 predicted 841
9 SASI_Mm01_00268643 predicted 2134
10 SASI_Mm01_00268644 predicted 1577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016281
VALIDATED
TAOK3 MISSION shRNA Bacterial Glycerol Stock
TAO kinase 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016281.x-2864s1c1
Sequence:CCGGAGCGAGAGAATAAAGAACCTACTCGAGTAGGTTCTTTATTCTCTCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016281.x-3210s1c1
Sequence:CCGGCCGTCTCTTCTATTCACAGTACTCGAGTACTGTGAATAGAAGAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016281.x-1326s1c1
Sequence:CCGGGCAGCAACCATTCCATTCCAACTCGAGTTGGAATGGAATGGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016281.x-2888s1c1
Sequence:CCGGGAAAGGCAAGAGCGAGAGATTCTCGAGAATCTCTCGCTCTTGCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016281.x-2354s1c1
Sequence:CCGGGAGTACAATAAGAGGCGAGAACTCGAGTTCTCGCCTCTTATTGTACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016281.2-326s1c1
Sequence:CCGGGCCGATCTATTCTACAAAGATCTCGAGATCTTTGTAGAATAGATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194986    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016281.2-3233s1c1
Sequence:CCGGCGTCACAGTATTGATGTGATTCTCGAGAATCACATCAATACTGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-2229s21c1
Sequence:GTACCGGGAGCGGATCTCCAAACATAAACTCGAGTTTATGTTTGGAGATCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016281.3-3637s21c1
Sequence:CCGGTAACTAGCTGCTGCATTATTTCTCGAGAAATAATGCAGCAGCTAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-3087s21c1
Sequence:CCGGGAAAGGCAAGAGCGAGAGATTCTCGAGAATCTCTCGCTCTTGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-1639s21c1
Sequence:CCGGATGACGAAAGCACAATCAATTCTCGAGAATTGATTGTGCTTTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-1865s21c1
Sequence:CCGGGGAACAGATGTCAGGTTATAACTCGAGTTATAACCTGACATCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-890s21c1
Sequence:GTACCGGTGGACTAGCCTACCTACATTCCTCGAGGAATGTAGGTAGGCTAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-1789s21c1
Sequence:CCGGAGCGCTTTGCCACGATCAAATCTCGAGATTTGATCGTGGCAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016281
VALIDATED
TAOK3 MISSION shRNA shRNA Plasmid DNA
TAO kinase 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016281.x-2864s1c1
Sequence:CCGGAGCGAGAGAATAAAGAACCTACTCGAGTAGGTTCTTTATTCTCTCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016281.x-3210s1c1
Sequence:CCGGCCGTCTCTTCTATTCACAGTACTCGAGTACTGTGAATAGAAGAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016281.x-1326s1c1
Sequence:CCGGGCAGCAACCATTCCATTCCAACTCGAGTTGGAATGGAATGGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016281.x-2888s1c1
Sequence:CCGGGAAAGGCAAGAGCGAGAGATTCTCGAGAATCTCTCGCTCTTGCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016281.x-2354s1c1
Sequence:CCGGGAGTACAATAAGAGGCGAGAACTCGAGTTCTCGCCTCTTATTGTACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016281.2-326s1c1
Sequence:CCGGGCCGATCTATTCTACAAAGATCTCGAGATCTTTGTAGAATAGATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194986    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016281.2-3233s1c1
Sequence:CCGGCGTCACAGTATTGATGTGATTCTCGAGAATCACATCAATACTGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-2229s21c1
Sequence:GTACCGGGAGCGGATCTCCAAACATAAACTCGAGTTTATGTTTGGAGATCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016281.3-3637s21c1
Sequence:CCGGTAACTAGCTGCTGCATTATTTCTCGAGAAATAATGCAGCAGCTAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-3087s21c1
Sequence:CCGGGAAAGGCAAGAGCGAGAGATTCTCGAGAATCTCTCGCTCTTGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-1639s21c1
Sequence:CCGGATGACGAAAGCACAATCAATTCTCGAGAATTGATTGTGCTTTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-1865s21c1
Sequence:CCGGGGAACAGATGTCAGGTTATAACTCGAGTTATAACCTGACATCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-890s21c1
Sequence:GTACCGGTGGACTAGCCTACCTACATTCCTCGAGGAATGTAGGTAGGCTAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-1789s21c1
Sequence:CCGGAGCGCTTTGCCACGATCAAATCTCGAGATTTGATCGTGGCAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016281
VALIDATED
TAOK3 MISSION shRNA Lentiviral Transduction Particles
TAO kinase 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016281.x-2864s1c1
Sequence:CCGGAGCGAGAGAATAAAGAACCTACTCGAGTAGGTTCTTTATTCTCTCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016281.x-3210s1c1
Sequence:CCGGCCGTCTCTTCTATTCACAGTACTCGAGTACTGTGAATAGAAGAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016281.x-1326s1c1
Sequence:CCGGGCAGCAACCATTCCATTCCAACTCGAGTTGGAATGGAATGGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016281.x-2888s1c1
Sequence:CCGGGAAAGGCAAGAGCGAGAGATTCTCGAGAATCTCTCGCTCTTGCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016281.x-2354s1c1
Sequence:CCGGGAGTACAATAAGAGGCGAGAACTCGAGTTCTCGCCTCTTATTGTACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016281.2-326s1c1
Sequence:CCGGGCCGATCTATTCTACAAAGATCTCGAGATCTTTGTAGAATAGATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194986    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016281.2-3233s1c1
Sequence:CCGGCGTCACAGTATTGATGTGATTCTCGAGAATCACATCAATACTGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-2229s21c1
Sequence:GTACCGGGAGCGGATCTCCAAACATAAACTCGAGTTTATGTTTGGAGATCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016281.3-3637s21c1
Sequence:CCGGTAACTAGCTGCTGCATTATTTCTCGAGAAATAATGCAGCAGCTAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-3087s21c1
Sequence:CCGGGAAAGGCAAGAGCGAGAGATTCTCGAGAATCTCTCGCTCTTGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-1639s21c1
Sequence:CCGGATGACGAAAGCACAATCAATTCTCGAGAATTGATTGTGCTTTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-1865s21c1
Sequence:CCGGGGAACAGATGTCAGGTTATAACTCGAGTTATAACCTGACATCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-890s21c1
Sequence:GTACCGGTGGACTAGCCTACCTACATTCCTCGAGGAATGTAGGTAGGCTAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016281.3-1789s21c1
Sequence:CCGGAGCGCTTTGCCACGATCAAATCTCGAGATTTGATCGTGGCAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081308
VALIDATED
TAOK3 MISSION shRNA Bacterial Glycerol Stock
TAO kinase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081308.1-410s21c1
Sequence:CCGGCAACGAGGTGGTCGCTGTTAACTCGAGTTAACAGCGACCACCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081308.1-1570s21c1
Sequence:CCGGAGCGCTTTGCCACGATCAAATCTCGAGATTTGATCGTGGCAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081308.1-1019s21c1
Sequence:CCGGCTTCAGGAGATTCGTTGATTACTCGAGTAATCAACGAATCTCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081308.1-2010s21c1
Sequence:CCGGGAGCGGATATCGAAGCATAAACTCGAGTTTATGCTTCGATATCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081308.1-381s21c1
Sequence:CCGGGCCGTGTACTTTGCGACAAATCTCGAGATTTGTCGCAAAGTACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081308
VALIDATED
TAOK3 MISSION shRNA shRNA Plasmid DNA
TAO kinase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081308.1-410s21c1
Sequence:CCGGCAACGAGGTGGTCGCTGTTAACTCGAGTTAACAGCGACCACCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081308.1-1570s21c1
Sequence:CCGGAGCGCTTTGCCACGATCAAATCTCGAGATTTGATCGTGGCAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081308.1-1019s21c1
Sequence:CCGGCTTCAGGAGATTCGTTGATTACTCGAGTAATCAACGAATCTCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081308.1-2010s21c1
Sequence:CCGGGAGCGGATATCGAAGCATAAACTCGAGTTTATGCTTCGATATCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081308.1-381s21c1
Sequence:CCGGGCCGTGTACTTTGCGACAAATCTCGAGATTTGTCGCAAAGTACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081308
VALIDATED
TAOK3 MISSION shRNA Lentiviral Transduction Particles
TAO kinase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081308.1-410s21c1
Sequence:CCGGCAACGAGGTGGTCGCTGTTAACTCGAGTTAACAGCGACCACCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081308.1-1570s21c1
Sequence:CCGGAGCGCTTTGCCACGATCAAATCTCGAGATTTGATCGTGGCAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081308.1-1019s21c1
Sequence:CCGGCTTCAGGAGATTCGTTGATTACTCGAGTAATCAACGAATCTCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081308.1-2010s21c1
Sequence:CCGGGAGCGGATATCGAAGCATAAACTCGAGTTTATGCTTCGATATCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081308.1-381s21c1
Sequence:CCGGGCCGTGTACTTTGCGACAAATCTCGAGATTTGTCGCAAAGTACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks