EMAIL THIS PAGE TO A FRIEND

TAP1

transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)

Synonyms: ABC17 ABCB2 APT1 D6S114E PSF-1 PSF1 RING4 TAP1*0102N TAP1N
UniProtKB ID: Q03518, Q16149, Q96CP4
Gene ID:
Human(6890) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in the pumping of degraded cytosolic peptides across the endoplasmic reticulum into the membrane-bound compartment where class I molecules assemble. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. [provided by RefSeq, Jul 2008]
Mouse(21354) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Rat(24811) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Thale Cress(843398) ABC transporter B family member 26
Zebrafish(100333043) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
chicken(427727) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
dog(474866) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
domestic cat(101083591) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
cow(524959) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
sheep(101115580) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
naked mole-rat(101711399) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Domestic Rabbit(100349155) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
domestic guinea pig(100716745) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000593 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013683 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013683 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013683 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000593 Rosetta Predictions human pricing
NM_032055 Rosetta Predictions rat pricing
NM_013683 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302866 predicted 1182
2 SASI_Hs01_00064341 predicted 1560
3 SASI_Hs01_00064342 predicted 1405
4 SASI_Hs01_00064343 predicted 2296
5 SASI_Hs01_00064344 predicted 1806
6 SASI_Hs01_00064345 predicted 1817
7 SASI_Hs01_00064346 predicted 2096
8 SASI_Hs01_00064347 predicted 1591
9 SASI_Hs01_00064348 predicted 733
10 SASI_Hs01_00064349 predicted 983
11 SASI_Hs01_00064340 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051800 predicted 1840
2 SASI_Rn01_00051804 predicted 1507
3 SASI_Rn02_00265387 predicted 651
4 SASI_Rn02_00265388 predicted 638
5 SASI_Rn01_00051802 predicted 570
6 SASI_Rn02_00265389 predicted 618
7 SASI_Rn01_00051803 predicted 773
8 SASI_Rn01_00051805 predicted 1682
9 SASI_Rn01_00051806 predicted 1314
10 SASI_Rn01_00051808 predicted 829
11 SASI_Rn01_00051801 predicted 943
12 SASI_Rn01_00051807 predicted 2563
13 SASI_Rn01_00051809 predicted 1799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029600 predicted 1674
2 SASI_Mm01_00029601 predicted 481
3 SASI_Mm01_00029603 predicted 1104
4 SASI_Mm01_00029604 predicted 1029
5 SASI_Mm01_00029605 predicted 1247
6 SASI_Mm01_00029606 predicted 658
7 SASI_Mm01_00029607 predicted 648
8 SASI_Mm01_00029608 predicted 642
9 SASI_Mm02_00322552 predicted 1093
10 SASI_Mm02_00322553 predicted 1101
11 SASI_Mm01_00029602 predicted 312
12 SASI_Mm01_00029609 predicted 307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000593
VALIDATED
TAP1 MISSION shRNA Bacterial Glycerol Stock
transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000593.5-998s21c1
Sequence:CCGGCGATACCTTCACTCGAAACTTCTCGAGAAGTTTCGAGTGAAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000593.5-1073s21c1
Sequence:CCGGCGGGATCTATAACAACACCATCTCGAGATGGTGTTGTTATAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000593.5-2316s21c1
Sequence:CCGGCCGTGTGTACTTATCCTGGATCTCGAGATCCAGGATAAGTACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_000593.5-1664s21c1
Sequence:CCGGCCTTGTCACATTTGTTCTCTACTCGAGTAGAGAACAAATGTGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-1082s1c1
Sequence:CCGGCGGGATCTATAACAACACCATCTCGAGATGGTGTTGTTATAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-1007s1c1
Sequence:CCGGCGATACCTTCACTCGAAACTTCTCGAGAAGTTTCGAGTGAAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-1673s1c1
Sequence:CCGGCCTTGTCACATTTGTTCTCTACTCGAGTAGAGAACAAATGTGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-1226s1c1
Sequence:CCGGCCTGAGTGATTCTCTGAGTGACTCGAGTCACTCAGAGAATCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-2325s1c1
Sequence:CCGGCCGTGTGTACTTATCCTGGATCTCGAGATCCAGGATAAGTACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000593
VALIDATED
TAP1 MISSION shRNA shRNA Plasmid DNA
transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000593.5-998s21c1
Sequence:CCGGCGATACCTTCACTCGAAACTTCTCGAGAAGTTTCGAGTGAAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000593.5-1073s21c1
Sequence:CCGGCGGGATCTATAACAACACCATCTCGAGATGGTGTTGTTATAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000593.5-2316s21c1
Sequence:CCGGCCGTGTGTACTTATCCTGGATCTCGAGATCCAGGATAAGTACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_000593.5-1664s21c1
Sequence:CCGGCCTTGTCACATTTGTTCTCTACTCGAGTAGAGAACAAATGTGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-1082s1c1
Sequence:CCGGCGGGATCTATAACAACACCATCTCGAGATGGTGTTGTTATAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-1007s1c1
Sequence:CCGGCGATACCTTCACTCGAAACTTCTCGAGAAGTTTCGAGTGAAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-1673s1c1
Sequence:CCGGCCTTGTCACATTTGTTCTCTACTCGAGTAGAGAACAAATGTGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-1226s1c1
Sequence:CCGGCCTGAGTGATTCTCTGAGTGACTCGAGTCACTCAGAGAATCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-2325s1c1
Sequence:CCGGCCGTGTGTACTTATCCTGGATCTCGAGATCCAGGATAAGTACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000593
VALIDATED
TAP1 MISSION shRNA Lentiviral Transduction Particles
transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000593.5-998s21c1
Sequence:CCGGCGATACCTTCACTCGAAACTTCTCGAGAAGTTTCGAGTGAAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000593.5-1073s21c1
Sequence:CCGGCGGGATCTATAACAACACCATCTCGAGATGGTGTTGTTATAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000593.5-2316s21c1
Sequence:CCGGCCGTGTGTACTTATCCTGGATCTCGAGATCCAGGATAAGTACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_000593.5-1664s21c1
Sequence:CCGGCCTTGTCACATTTGTTCTCTACTCGAGTAGAGAACAAATGTGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-1082s1c1
Sequence:CCGGCGGGATCTATAACAACACCATCTCGAGATGGTGTTGTTATAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-1007s1c1
Sequence:CCGGCGATACCTTCACTCGAAACTTCTCGAGAAGTTTCGAGTGAAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-1673s1c1
Sequence:CCGGCCTTGTCACATTTGTTCTCTACTCGAGTAGAGAACAAATGTGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-1226s1c1
Sequence:CCGGCCTGAGTGATTCTCTGAGTGACTCGAGTCACTCAGAGAATCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000593.4-2325s1c1
Sequence:CCGGCCGTGTGTACTTATCCTGGATCTCGAGATCCAGGATAAGTACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013683
TAP1 MISSION shRNA Bacterial Glycerol Stock
transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-1791s1c1
Sequence:CCGGCCACGATTTCATCTCTGGGTTCTCGAGAACCCAGAGATGAAATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-1257s1c1
Sequence:CCGGCCTTGTCTCATTCGTTCTCTACTCGAGTAGAGAACGAATGAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-1691s1c1
Sequence:CCGGCGCTGCTATTTGGAAGAAGTTCTCGAGAACTTCTTCCAAATAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-556s1c1
Sequence:CCGGCGCATCACTGACTGGATTCTTCTCGAGAAGAATCCAGTCAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-309s1c1
Sequence:CCGGCGCTGGATTACTGTACTGGAACTCGAGTTCCAGTACAGTAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013683
TAP1 MISSION shRNA shRNA Plasmid DNA
transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-1791s1c1
Sequence:CCGGCCACGATTTCATCTCTGGGTTCTCGAGAACCCAGAGATGAAATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-1257s1c1
Sequence:CCGGCCTTGTCTCATTCGTTCTCTACTCGAGTAGAGAACGAATGAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-1691s1c1
Sequence:CCGGCGCTGCTATTTGGAAGAAGTTCTCGAGAACTTCTTCCAAATAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-556s1c1
Sequence:CCGGCGCATCACTGACTGGATTCTTCTCGAGAAGAATCCAGTCAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-309s1c1
Sequence:CCGGCGCTGGATTACTGTACTGGAACTCGAGTTCCAGTACAGTAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013683
TAP1 MISSION shRNA Lentiviral Transduction Particles
transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-1791s1c1
Sequence:CCGGCCACGATTTCATCTCTGGGTTCTCGAGAACCCAGAGATGAAATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-1257s1c1
Sequence:CCGGCCTTGTCTCATTCGTTCTCTACTCGAGTAGAGAACGAATGAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-1691s1c1
Sequence:CCGGCGCTGCTATTTGGAAGAAGTTCTCGAGAACTTCTTCCAAATAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-556s1c1
Sequence:CCGGCGCATCACTGACTGGATTCTTCTCGAGAAGAATCCAGTCAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013683.1-309s1c1
Sequence:CCGGCGCTGGATTACTGTACTGGAACTCGAGTTCCAGTACAGTAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks