EMAIL THIS PAGE TO A FRIEND

TAP2

transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)

Synonyms: ABC18 ABCB3 APT2 D6S217E PSF-2 PSF2 RING11
Gene ID:
Human(6891) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene is located 7 kb telomeric to gene family member ABCB2. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with ABCB2 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Alternative splicing of this gene produces two products which differ in peptide selectivity and level of restoration of surface expression of MHC class I molecules. [provided by RefSeq, Jul 2008]
Mouse(21355) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Rat(24812) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
domestic guinea pig(100717574) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
naked mole-rat(101703007) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
cow(281586) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
sheep(101109491) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Thale Cress(833896) ABC transporter B family member 27
chicken(427728) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
dog(474864) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Horse(100052423) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
domestic cat(101089770) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Gene Class: Dehydratase
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000544 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000544 Rosetta Predictions human pricing
NM_018833 Rosetta Predictions human pricing
NM_032056 Rosetta Predictions rat pricing
NM_011530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151065 predicted 1343
2 SASI_Hs01_00151066 predicted 1164
3 SASI_Hs01_00151067 predicted 628
4 SASI_Hs01_00151068 predicted 618
5 SASI_Hs01_00151069 predicted 621
6 SASI_Hs02_00302765 predicted 827
7 SASI_Hs01_00151070 predicted 1169
8 SASI_Hs01_00151071 predicted 831
9 SASI_Hs01_00151072 predicted 958
10 SASI_Hs01_00151073 predicted 884
11 SASI_Hs01_00151074 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063213 predicted 1338
2 SASI_Hs01_00063214 predicted 1162
3 SASI_Hs01_00063215 predicted 625
4 SASI_Hs01_00063216 predicted 611
5 SASI_Hs01_00063217 predicted 621
6 SASI_Hs02_00352276 predicted 830
7 SASI_Hs01_00063218 predicted 1162
8 SASI_Hs01_00063219 predicted 836
9 SASI_Hs01_00063220 predicted 957
10 SASI_Hs01_00063221 predicted 886
11 SASI_Hs01_00063222 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080219 predicted 917
2 SASI_Rn02_00265390 predicted 513
3 SASI_Rn02_00265391 predicted 474
4 SASI_Rn01_00080226 predicted 527
5 SASI_Rn02_00265392 predicted 1725
6 SASI_Rn02_00265393 predicted 814
7 SASI_Rn02_00265394 predicted 1847
8 SASI_Rn02_00265395 predicted 1504
9 SASI_Rn02_00265396 predicted 1784
10 SASI_Rn02_00265397 predicted 1158
11 SASI_Rn01_00080220 predicted 588
12 SASI_Rn01_00080221 predicted 1906
13 SASI_Rn01_00080222 predicted 501
14 SASI_Rn01_00080223 predicted 1574
15 SASI_Rn01_00080224 predicted 1208
16 SASI_Rn01_00080225 predicted 1927
17 SASI_Rn01_00080227 predicted 547
18 SASI_Rn01_00080228 predicted 1863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140089 predicted 564
2 SASI_Mm01_00140090 predicted 623
3 SASI_Mm01_00140091 predicted 2095
4 SASI_Mm01_00140092 predicted 1663
5 SASI_Mm01_00140094 predicted 1326
6 SASI_Mm01_00140095 predicted 2019
7 SASI_Mm01_00140096 predicted 553
8 SASI_Mm01_00140097 predicted 1872
9 SASI_Mm01_00140098 predicted 719
10 SASI_Mm02_00320851 predicted 773
11 SASI_Mm01_00140093 predicted 969
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000544
VALIDATED
TAP2 MISSION shRNA Bacterial Glycerol Stock
transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000544.2-486s1c1
Sequence:CCGGCCAGGTGAACAACAAAGTCTTCTCGAGAAGACTTTGTTGTTCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000544.2-1512s1c1
Sequence:CCGGCGTCTCCTTTGCATATCCCAACTCGAGTTGGGATATGCAAAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_000544.2-873s1c1
Sequence:CCGGGATGAGTAACTGGCTTCCTTTCTCGAGAAAGGAAGCCAGTTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000544.2-1143s1c1
Sequence:CCGGGCATGAAGTCTGTCGCTATAACTCGAGTTATAGCGACAGACTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000544.2-1767s1c1
Sequence:CCGGCGGTTCTGTGAGGAACAACATCTCGAGATGTTGTTCCTCACAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000544.3-2080s21c1
Sequence:CCGGATCGCACAGTGCTGGTGATTGCTCGAGCAATCACCAGCACTGTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000544.3-653s21c1
Sequence:CCGGTGACATCCTGGGAGGTGATTTCTCGAGAAATCACCTCCCAGGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000544.3-1170s21c1
Sequence:CCGGCATGAAGTCTGTCGCTATAAACTCGAGTTTATAGCGACAGACTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000544.3-2636s21c1
Sequence:CCGGCTGTCCCATCAGTCGTTTATCCTCGAGGATAAACGACTGATGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000544.3-619s21c1
Sequence:CCGGAGACATTAATCCCTCACTATTCTCGAGAATAGTGAGGGATTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000544
VALIDATED
TAP2 MISSION shRNA shRNA Plasmid DNA
transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000544.2-486s1c1
Sequence:CCGGCCAGGTGAACAACAAAGTCTTCTCGAGAAGACTTTGTTGTTCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000544.2-1512s1c1
Sequence:CCGGCGTCTCCTTTGCATATCCCAACTCGAGTTGGGATATGCAAAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_000544.2-873s1c1
Sequence:CCGGGATGAGTAACTGGCTTCCTTTCTCGAGAAAGGAAGCCAGTTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000544.2-1143s1c1
Sequence:CCGGGCATGAAGTCTGTCGCTATAACTCGAGTTATAGCGACAGACTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000544.2-1767s1c1
Sequence:CCGGCGGTTCTGTGAGGAACAACATCTCGAGATGTTGTTCCTCACAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000544.3-2080s21c1
Sequence:CCGGATCGCACAGTGCTGGTGATTGCTCGAGCAATCACCAGCACTGTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000544.3-653s21c1
Sequence:CCGGTGACATCCTGGGAGGTGATTTCTCGAGAAATCACCTCCCAGGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000544.3-1170s21c1
Sequence:CCGGCATGAAGTCTGTCGCTATAAACTCGAGTTTATAGCGACAGACTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000544.3-2636s21c1
Sequence:CCGGCTGTCCCATCAGTCGTTTATCCTCGAGGATAAACGACTGATGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000544.3-619s21c1
Sequence:CCGGAGACATTAATCCCTCACTATTCTCGAGAATAGTGAGGGATTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000544
VALIDATED
TAP2 MISSION shRNA Lentiviral Transduction Particles
transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000544.2-486s1c1
Sequence:CCGGCCAGGTGAACAACAAAGTCTTCTCGAGAAGACTTTGTTGTTCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000544.2-1512s1c1
Sequence:CCGGCGTCTCCTTTGCATATCCCAACTCGAGTTGGGATATGCAAAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_000544.2-873s1c1
Sequence:CCGGGATGAGTAACTGGCTTCCTTTCTCGAGAAAGGAAGCCAGTTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000544.2-1143s1c1
Sequence:CCGGGCATGAAGTCTGTCGCTATAACTCGAGTTATAGCGACAGACTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000544.2-1767s1c1
Sequence:CCGGCGGTTCTGTGAGGAACAACATCTCGAGATGTTGTTCCTCACAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000544.3-2080s21c1
Sequence:CCGGATCGCACAGTGCTGGTGATTGCTCGAGCAATCACCAGCACTGTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000544.3-653s21c1
Sequence:CCGGTGACATCCTGGGAGGTGATTTCTCGAGAAATCACCTCCCAGGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000544.3-1170s21c1
Sequence:CCGGCATGAAGTCTGTCGCTATAAACTCGAGTTTATAGCGACAGACTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000544.3-2636s21c1
Sequence:CCGGCTGTCCCATCAGTCGTTTATCCTCGAGGATAAACGACTGATGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000544.3-619s21c1
Sequence:CCGGAGACATTAATCCCTCACTATTCTCGAGAATAGTGAGGGATTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011530
TAP2 MISSION shRNA Bacterial Glycerol Stock
transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-852s1c1
Sequence:CCGGGCTCCCTTTCAATGCCAATATCTCGAGATATTGGCATTGAAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-132s1c1
Sequence:CCGGGCTACAAGGATCTCTGGGAAACTCGAGTTTCCCAGAGATCCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-456s1c1
Sequence:CCGGCCAGGAGAACAGAACACTGATCTCGAGATCAGTGTTCTGTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-559s1c1
Sequence:CCGGGAGACATTAATCCCTCGCTATCTCGAGATAGCGAGGGATTAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-1733s1c1
Sequence:CCGGCGGGTTCTGTCAAGGACAATACTCGAGTATTGTCCTTGACAGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011530
TAP2 MISSION shRNA shRNA Plasmid DNA
transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-852s1c1
Sequence:CCGGGCTCCCTTTCAATGCCAATATCTCGAGATATTGGCATTGAAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-132s1c1
Sequence:CCGGGCTACAAGGATCTCTGGGAAACTCGAGTTTCCCAGAGATCCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-456s1c1
Sequence:CCGGCCAGGAGAACAGAACACTGATCTCGAGATCAGTGTTCTGTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-559s1c1
Sequence:CCGGGAGACATTAATCCCTCGCTATCTCGAGATAGCGAGGGATTAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-1733s1c1
Sequence:CCGGCGGGTTCTGTCAAGGACAATACTCGAGTATTGTCCTTGACAGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011530
TAP2 MISSION shRNA Lentiviral Transduction Particles
transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-852s1c1
Sequence:CCGGGCTCCCTTTCAATGCCAATATCTCGAGATATTGGCATTGAAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-132s1c1
Sequence:CCGGGCTACAAGGATCTCTGGGAAACTCGAGTTTCCCAGAGATCCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-456s1c1
Sequence:CCGGCCAGGAGAACAGAACACTGATCTCGAGATCAGTGTTCTGTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-559s1c1
Sequence:CCGGGAGACATTAATCCCTCGCTATCTCGAGATAGCGAGGGATTAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011530.2-1733s1c1
Sequence:CCGGCGGGTTCTGTCAAGGACAATACTCGAGTATTGTCCTTGACAGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks