EMAIL THIS PAGE TO A FRIEND

TAPBP

TAP binding protein (tapasin)

Synonyms: NGS17 TAPA TPN TPSN
Gene ID:
Human(6892) Summary: This gene encodes a transmembrane glycoprotein which mediates interaction between newly assembled major histocompatibility complex (MHC) class I molecules and the transporter associated with antigen processing (TAP), which is required for the transport of antigenic peptides across the endoplasmic reticulum membrane. This interaction is essential for optimal peptide loading on the MHC class I molecule. Up to four complexes of MHC class I and this protein may be bound to a single TAP molecule. This protein contains a C-terminal double-lysine motif (KKKAE) known to maintain membrane proteins in the endoplasmic reticulum. This gene lies within the major histocompatibility complex on chromosome 6. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(21356) TAP binding protein
Rat(25217) TAP binding protein (tapasin)
Zebrafish(30163) TAP binding protein
chicken(417048) TAP binding protein (tapasin)
domestic cat(101091023) TAP binding protein (tapasin)
Horse(100061515) TAP binding protein (tapasin)
dog(481740) TAP binding protein (tapasin)
cow(504335) TAP binding protein (tapasin)
sheep(100170652) TAP binding protein (tapasin)
naked mole-rat(101719224) TAP binding protein (tapasin)
domestic guinea pig(100735947) TAP binding protein (tapasin)
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009318 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009318 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009318 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003190 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159331 MISSION® esiRNA esiRNA human TAPBP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003190 Rosetta Predictions human pricing
NM_172208 Rosetta Predictions human pricing
NM_172209 Rosetta Predictions human pricing
NM_033098 Rosetta Predictions rat pricing
NM_001025313 Rosetta Predictions mouse pricing
NM_009318 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118378 predicted 680
2 SASI_Hs01_00118379 predicted 671
3 SASI_Hs01_00118380 predicted 235
4 SASI_Hs01_00118381 predicted 532
5 SASI_Hs01_00118382 predicted 628
6 SASI_Hs01_00118383 predicted 534
7 SASI_Hs01_00118384 predicted 690
8 SASI_Hs01_00118385 predicted 681
9 SASI_Hs02_00335230 predicted 672
10 SASI_Hs01_00118387 predicted 676
11 SASI_Hs01_00118386 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028828 predicted 677
2 SASI_Hs01_00028829 predicted 669
3 SASI_Hs01_00028830 predicted 232
4 SASI_Hs01_00028831 predicted 532
5 SASI_Hs01_00028832 predicted 631
6 SASI_Hs01_00028833 predicted 538
7 SASI_Hs01_00028834 predicted 689
8 SASI_Hs01_00028835 predicted 682
9 SASI_Hs02_00367915 predicted 667
10 SASI_Hs01_00028837 predicted 672
11 SASI_Hs01_00028836 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167796 predicted 686
2 SASI_Hs01_00167797 predicted 677
3 SASI_Hs01_00167798 predicted 235
4 SASI_Hs01_00167799 predicted 528
5 SASI_Hs01_00167800 predicted 631
6 SASI_Hs01_00167801 predicted 540
7 SASI_Hs01_00167802 predicted 694
8 SASI_Hs01_00167803 predicted 686
9 SASI_Hs02_00367916 predicted 675
10 SASI_Hs01_00167805 predicted 679
11 SASI_Hs01_00167804 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035835 predicted 988
2 SASI_Rn01_00035836 predicted 1245
3 SASI_Rn01_00035837 predicted 1212
4 SASI_Rn01_00035839 predicted 826
5 SASI_Rn01_00035840 predicted 815
6 SASI_Rn01_00035841 predicted 773
7 SASI_Rn01_00035843 predicted 1059
8 SASI_Rn01_00035844 predicted 513
9 SASI_Rn02_00265506 predicted 1017
10 SASI_Rn02_00265507 predicted 1131
11 SASI_Rn01_00035838 predicted 1139
12 SASI_Rn01_00035842 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287830 predicted 658
2 SASI_Mm02_00287831 predicted 1013
3 SASI_Mm02_00287832 predicted 1191
4 SASI_Mm02_00287833 predicted 393
5 SASI_Mm02_00287834 predicted 1276
6 SASI_Mm02_00287835 predicted 396
7 SASI_Mm02_00287836 predicted 594
8 SASI_Mm02_00287837 predicted 400
9 SASI_Mm02_00287838 predicted 525
10 SASI_Mm02_00287839 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315854 predicted 661
2 SASI_Mm02_00315855 predicted 1017
3 SASI_Mm02_00315856 predicted 1196
4 SASI_Mm02_00315857 predicted 384
5 SASI_Mm02_00315858 predicted 1275
6 SASI_Mm02_00315859 predicted 398
7 SASI_Mm02_00315860 predicted 595
8 SASI_Mm02_00315861 predicted 405
9 SASI_Mm02_00315862 predicted 526
10 SASI_Mm02_00315863 predicted 327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009318
VALIDATED
TAPBP MISSION shRNA Bacterial Glycerol Stock
TAP binding protein (tapasin)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009318.2-1461s21c1
Sequence:CCGGCGGCCTGTTCCTGTCTGCTTTCTCGAGAAAGCAGACAGGAACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009318.2-1224s21c1
Sequence:CCGGCCCAGGAGGAAGTTCTAGAAACTCGAGTTTCTAGAACTTCCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009318.2-402s21c1
Sequence:CCGGCCCAAAGCTATACTTCAAGGTCTCGAGACCTTGAAGTATAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009318.2-597s21c1
Sequence:CCGGCAGCGTATCCAGCACTCTCTTCTCGAGAAGAGAGTGCTGGATACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-597s1c1
Sequence:CCGGCAGCGTATCCAGCACTCTCTTCTCGAGAAGAGAGTGCTGGATACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-1461s1c1
Sequence:CCGGCGGCCTGTTCCTGTCTGCTTTCTCGAGAAAGCAGACAGGAACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-402s1c1
Sequence:CCGGCCCAAAGCTATACTTCAAGGTCTCGAGACCTTGAAGTATAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-1224s1c1
Sequence:CCGGCCCAGGAGGAAGTTCTAGAAACTCGAGTTTCTAGAACTTCCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-2350s1c1
Sequence:CCGGCCATCGGAAATACCAGACATTCTCGAGAATGTCTGGTATTTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009318
VALIDATED
TAPBP MISSION shRNA shRNA Plasmid DNA
TAP binding protein (tapasin)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009318.2-1461s21c1
Sequence:CCGGCGGCCTGTTCCTGTCTGCTTTCTCGAGAAAGCAGACAGGAACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009318.2-1224s21c1
Sequence:CCGGCCCAGGAGGAAGTTCTAGAAACTCGAGTTTCTAGAACTTCCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009318.2-402s21c1
Sequence:CCGGCCCAAAGCTATACTTCAAGGTCTCGAGACCTTGAAGTATAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009318.2-597s21c1
Sequence:CCGGCAGCGTATCCAGCACTCTCTTCTCGAGAAGAGAGTGCTGGATACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-597s1c1
Sequence:CCGGCAGCGTATCCAGCACTCTCTTCTCGAGAAGAGAGTGCTGGATACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-1461s1c1
Sequence:CCGGCGGCCTGTTCCTGTCTGCTTTCTCGAGAAAGCAGACAGGAACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-402s1c1
Sequence:CCGGCCCAAAGCTATACTTCAAGGTCTCGAGACCTTGAAGTATAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-1224s1c1
Sequence:CCGGCCCAGGAGGAAGTTCTAGAAACTCGAGTTTCTAGAACTTCCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-2350s1c1
Sequence:CCGGCCATCGGAAATACCAGACATTCTCGAGAATGTCTGGTATTTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009318
VALIDATED
TAPBP MISSION shRNA Lentiviral Transduction Particles
TAP binding protein (tapasin)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009318.2-1461s21c1
Sequence:CCGGCGGCCTGTTCCTGTCTGCTTTCTCGAGAAAGCAGACAGGAACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009318.2-1224s21c1
Sequence:CCGGCCCAGGAGGAAGTTCTAGAAACTCGAGTTTCTAGAACTTCCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009318.2-402s21c1
Sequence:CCGGCCCAAAGCTATACTTCAAGGTCTCGAGACCTTGAAGTATAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009318.2-597s21c1
Sequence:CCGGCAGCGTATCCAGCACTCTCTTCTCGAGAAGAGAGTGCTGGATACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-597s1c1
Sequence:CCGGCAGCGTATCCAGCACTCTCTTCTCGAGAAGAGAGTGCTGGATACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-1461s1c1
Sequence:CCGGCGGCCTGTTCCTGTCTGCTTTCTCGAGAAAGCAGACAGGAACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-402s1c1
Sequence:CCGGCCCAAAGCTATACTTCAAGGTCTCGAGACCTTGAAGTATAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-1224s1c1
Sequence:CCGGCCCAGGAGGAAGTTCTAGAAACTCGAGTTTCTAGAACTTCCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009318.2-2350s1c1
Sequence:CCGGCCATCGGAAATACCAGACATTCTCGAGAATGTCTGGTATTTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003190
VALIDATED
TAPBP MISSION shRNA Bacterial Glycerol Stock
TAP binding protein (tapasin)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-1303s21c1
Sequence:CCGGGCACGCTATGCCTGTCGAATTCTCGAGAATTCGACAGGCATAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-535s21c1
Sequence:CCGGGCTTGGCTGATGGTCAGCATACTCGAGTATGCTGACCATCAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-2896s21c1
Sequence:CCGGGCGGCGAAACACGATATTGTACTCGAGTACAATATCGTGTTTCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-1482s21c1
Sequence:CCGGGTCCACCTGCAAGGATTCAAACTCGAGTTTGAATCCTTGCAGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-355s21c1
Sequence:CCGGCCTGAGCTCTATCTCAGTGTACTCGAGTACACTGAGATAGAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003190.3-355s1c1
Sequence:CCGGCCTGAGCTCTATCTCAGTGTACTCGAGTACACTGAGATAGAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003190.3-1303s1c1
Sequence:CCGGGCACGCTATGCCTGTCGAATTCTCGAGAATTCGACAGGCATAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003190.3-2896s1c1
Sequence:CCGGGCGGCGAAACACGATATTGTACTCGAGTACAATATCGTGTTTCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003190.3-1482s1c1
Sequence:CCGGGTCCACCTGCAAGGATTCAAACTCGAGTTTGAATCCTTGCAGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003190.3-535s1c1
Sequence:CCGGGCTTGGCTGATGGTCAGCATACTCGAGTATGCTGACCATCAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003190
VALIDATED
TAPBP MISSION shRNA shRNA Plasmid DNA
TAP binding protein (tapasin)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-1303s21c1
Sequence:CCGGGCACGCTATGCCTGTCGAATTCTCGAGAATTCGACAGGCATAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-535s21c1
Sequence:CCGGGCTTGGCTGATGGTCAGCATACTCGAGTATGCTGACCATCAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-2896s21c1
Sequence:CCGGGCGGCGAAACACGATATTGTACTCGAGTACAATATCGTGTTTCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-1482s21c1
Sequence:CCGGGTCCACCTGCAAGGATTCAAACTCGAGTTTGAATCCTTGCAGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-355s21c1
Sequence:CCGGCCTGAGCTCTATCTCAGTGTACTCGAGTACACTGAGATAGAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003190.3-355s1c1
Sequence:CCGGCCTGAGCTCTATCTCAGTGTACTCGAGTACACTGAGATAGAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003190.3-1303s1c1
Sequence:CCGGGCACGCTATGCCTGTCGAATTCTCGAGAATTCGACAGGCATAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003190.3-2896s1c1
Sequence:CCGGGCGGCGAAACACGATATTGTACTCGAGTACAATATCGTGTTTCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003190.3-1482s1c1
Sequence:CCGGGTCCACCTGCAAGGATTCAAACTCGAGTTTGAATCCTTGCAGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003190.3-535s1c1
Sequence:CCGGGCTTGGCTGATGGTCAGCATACTCGAGTATGCTGACCATCAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003190
VALIDATED
TAPBP MISSION shRNA Lentiviral Transduction Particles
TAP binding protein (tapasin)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-1303s21c1
Sequence:CCGGGCACGCTATGCCTGTCGAATTCTCGAGAATTCGACAGGCATAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-535s21c1
Sequence:CCGGGCTTGGCTGATGGTCAGCATACTCGAGTATGCTGACCATCAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-2896s21c1
Sequence:CCGGGCGGCGAAACACGATATTGTACTCGAGTACAATATCGTGTTTCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-1482s21c1
Sequence:CCGGGTCCACCTGCAAGGATTCAAACTCGAGTTTGAATCCTTGCAGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003190.3-355s21c1
Sequence:CCGGCCTGAGCTCTATCTCAGTGTACTCGAGTACACTGAGATAGAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003190.3-355s1c1
Sequence:CCGGCCTGAGCTCTATCTCAGTGTACTCGAGTACACTGAGATAGAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003190.3-1303s1c1
Sequence:CCGGGCACGCTATGCCTGTCGAATTCTCGAGAATTCGACAGGCATAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003190.3-2896s1c1
Sequence:CCGGGCGGCGAAACACGATATTGTACTCGAGTACAATATCGTGTTTCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003190.3-1482s1c1
Sequence:CCGGGTCCACCTGCAAGGATTCAAACTCGAGTTTGAATCCTTGCAGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003190.3-535s1c1
Sequence:CCGGGCTTGGCTGATGGTCAGCATACTCGAGTATGCTGACCATCAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks