EMAIL THIS PAGE TO A FRIEND

TAPBPL

TAP binding protein-like

Synonyms: TAPBP-R TAPBPR
UniProtKB ID: Q9BX59, Q9NWB8
Gene ID:
Human(55080) Summary: Tapasin, or TAPBP (MIM 601962), is a member of the variable-constant Ig superfamily that links major histocompatibility complex (MHC) class I molecules to the transporter associated with antigen processing (TAP; see MIM 170260) in the endoplasmic reticulum (ER). The TAPBP gene is located near the MHC complex on chromosome 6p21.3. TAPBPL is a member of the Ig superfamily that is localized on chromosome 12p13.3, a region somewhat paralogous to the MHC.[supplied by OMIM, Mar 2008]
Mouse(213233) TAP binding protein-like
Rat(297602) TAP binding protein-like
domestic guinea pig(100712795) TAP binding protein-like
naked mole-rat(101701129) TAP binding protein-like
cow(529141) TAP binding protein-like
sheep(101114006) TAP binding protein-like
chicken(426340) TAP binding protein-like
dog(486727) TAP binding protein-like
domestic cat(101091880) TAP binding protein-like
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018009 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018009 Rosetta Predictions human pricing
NM_001106622 Rosetta Predictions rat pricing
NM_145391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179055 predicted 489
2 SASI_Hs01_00179056 predicted 1444
3 SASI_Hs01_00179057 predicted 595
4 SASI_Hs01_00179059 predicted 1153
5 SASI_Hs01_00179060 predicted 686
6 SASI_Hs01_00179061 predicted 523
7 SASI_Hs02_00351089 predicted 493
8 SASI_Hs01_00179063 predicted 1123
9 SASI_Hs01_00179064 predicted 1449
10 SASI_Hs02_00351090 predicted 586
11 SASI_Hs01_00179058 predicted 390
12 SASI_Hs01_00179062 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220758 predicted 811
2 SASI_Rn02_00220759 predicted 604
3 SASI_Rn02_00220760 predicted 1007
4 SASI_Rn02_00220761 predicted 592
5 SASI_Rn02_00220762 predicted 877
6 SASI_Rn02_00220763 predicted 745
7 SASI_Rn02_00220764 predicted 1467
8 SASI_Rn02_00220765 predicted 589
9 SASI_Rn02_00220766 predicted 1352
10 SASI_Rn02_00220767 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038322 predicted 371
2 SASI_Mm01_00038323 predicted 1157
3 SASI_Mm01_00038324 predicted 530
4 SASI_Mm01_00038325 predicted 1633
5 SASI_Mm01_00038326 predicted 541
6 SASI_Mm01_00038327 predicted 683
7 SASI_Mm01_00038328 predicted 828
8 SASI_Mm01_00038329 predicted 1368
9 SASI_Mm01_00038330 predicted 1523
10 SASI_Mm01_00038331 predicted 1298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018009
TAPBPL MISSION shRNA Bacterial Glycerol Stock
TAP binding protein-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-1135s1c1
Sequence:CCGGGCTGGCTATTACCCTCTGGATCTCGAGATCCAGAGGGTAATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-1413s1c1
Sequence:CCGGCTTCCTTCTTGCACTGATGTTCTCGAGAACATCAGTGCAAGAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-566s1c1
Sequence:CCGGCCACTGTTAAGACAGCAGCTTCTCGAGAAGCTGCTGTCTTAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-273s1c1
Sequence:CCGGCCTAGACTGTTTCCTGGTGAACTCGAGTTCACCAGGAAACAGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-425s1c1
Sequence:CCGGCCCAAGATGACCCACCTATTACTCGAGTAATAGGTGGGTCATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018009.4-814s21c1
Sequence:CCGGGGTGATGACACAGACCCAATCCTCGAGGATTGGGTCTGTGTCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018009.4-1653s21c1
Sequence:CCGGCGACATGAGACTACTAGAAAGCTCGAGCTTTCTAGTAGTCTCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018009.4-1455s21c1
Sequence:CCGGCAGCCTTGGGAGTCATCTTTGCTCGAGCAAAGATGACTCCCAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018009.4-1154s21c1
Sequence:CCGGGTACGACTGAGCTTGGCAAACCTCGAGGTTTGCCAAGCTCAGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018009
TAPBPL MISSION shRNA shRNA Plasmid DNA
TAP binding protein-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-1135s1c1
Sequence:CCGGGCTGGCTATTACCCTCTGGATCTCGAGATCCAGAGGGTAATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-1413s1c1
Sequence:CCGGCTTCCTTCTTGCACTGATGTTCTCGAGAACATCAGTGCAAGAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-566s1c1
Sequence:CCGGCCACTGTTAAGACAGCAGCTTCTCGAGAAGCTGCTGTCTTAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-273s1c1
Sequence:CCGGCCTAGACTGTTTCCTGGTGAACTCGAGTTCACCAGGAAACAGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-425s1c1
Sequence:CCGGCCCAAGATGACCCACCTATTACTCGAGTAATAGGTGGGTCATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018009.4-814s21c1
Sequence:CCGGGGTGATGACACAGACCCAATCCTCGAGGATTGGGTCTGTGTCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018009.4-1653s21c1
Sequence:CCGGCGACATGAGACTACTAGAAAGCTCGAGCTTTCTAGTAGTCTCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018009.4-1455s21c1
Sequence:CCGGCAGCCTTGGGAGTCATCTTTGCTCGAGCAAAGATGACTCCCAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018009.4-1154s21c1
Sequence:CCGGGTACGACTGAGCTTGGCAAACCTCGAGGTTTGCCAAGCTCAGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018009
TAPBPL MISSION shRNA Lentiviral Transduction Particles
TAP binding protein-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-1135s1c1
Sequence:CCGGGCTGGCTATTACCCTCTGGATCTCGAGATCCAGAGGGTAATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-1413s1c1
Sequence:CCGGCTTCCTTCTTGCACTGATGTTCTCGAGAACATCAGTGCAAGAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-566s1c1
Sequence:CCGGCCACTGTTAAGACAGCAGCTTCTCGAGAAGCTGCTGTCTTAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-273s1c1
Sequence:CCGGCCTAGACTGTTTCCTGGTGAACTCGAGTTCACCAGGAAACAGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018009.3-425s1c1
Sequence:CCGGCCCAAGATGACCCACCTATTACTCGAGTAATAGGTGGGTCATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018009.4-814s21c1
Sequence:CCGGGGTGATGACACAGACCCAATCCTCGAGGATTGGGTCTGTGTCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018009.4-1653s21c1
Sequence:CCGGCGACATGAGACTACTAGAAAGCTCGAGCTTTCTAGTAGTCTCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018009.4-1455s21c1
Sequence:CCGGCAGCCTTGGGAGTCATCTTTGCTCGAGCAAAGATGACTCCCAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018009.4-1154s21c1
Sequence:CCGGGTACGACTGAGCTTGGCAAACCTCGAGGTTTGCCAAGCTCAGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145391
VALIDATED
TAPBPL MISSION shRNA Bacterial Glycerol Stock
TAP binding protein-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145391.1-373s1c1
Sequence:CCGGCGGACATCATCTTAGACTGCTCTCGAGAGCAGTCTAAGATGATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145391.1-536s1c1
Sequence:CCGGCAAACAGGATTCACCTGTTATCTCGAGATAACAGGTGAATCCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145391.1-1155s21c1
Sequence:CCGGCAACAGATCATGCCACTTAACCTCGAGGTTAAGTGGCATGATCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145391.1-541s21c1
Sequence:CCGGAGGATTCACCTGTTATCTTTGCTCGAGCAAAGATAACAGGTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145391.1-1085s21c1
Sequence:CCGGCTTACCCAACCTCACTCTAAACTCGAGTTTAGAGTGAGGTTGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145391.1-638s21c1
Sequence:CCGGCTGCGAGATCTCCAAGTATTTCTCGAGAAATACTTGGAGATCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145391.1-1654s21c1
Sequence:CCGGTCCACATCCTGGCTACTTAAACTCGAGTTTAAGTAGCCAGGATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145391
VALIDATED
TAPBPL MISSION shRNA shRNA Plasmid DNA
TAP binding protein-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145391.1-373s1c1
Sequence:CCGGCGGACATCATCTTAGACTGCTCTCGAGAGCAGTCTAAGATGATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145391.1-536s1c1
Sequence:CCGGCAAACAGGATTCACCTGTTATCTCGAGATAACAGGTGAATCCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145391.1-1155s21c1
Sequence:CCGGCAACAGATCATGCCACTTAACCTCGAGGTTAAGTGGCATGATCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145391.1-541s21c1
Sequence:CCGGAGGATTCACCTGTTATCTTTGCTCGAGCAAAGATAACAGGTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145391.1-1085s21c1
Sequence:CCGGCTTACCCAACCTCACTCTAAACTCGAGTTTAGAGTGAGGTTGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145391.1-638s21c1
Sequence:CCGGCTGCGAGATCTCCAAGTATTTCTCGAGAAATACTTGGAGATCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145391.1-1654s21c1
Sequence:CCGGTCCACATCCTGGCTACTTAAACTCGAGTTTAAGTAGCCAGGATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145391
VALIDATED
TAPBPL MISSION shRNA Lentiviral Transduction Particles
TAP binding protein-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145391.1-373s1c1
Sequence:CCGGCGGACATCATCTTAGACTGCTCTCGAGAGCAGTCTAAGATGATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145391.1-536s1c1
Sequence:CCGGCAAACAGGATTCACCTGTTATCTCGAGATAACAGGTGAATCCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145391.1-1155s21c1
Sequence:CCGGCAACAGATCATGCCACTTAACCTCGAGGTTAAGTGGCATGATCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145391.1-541s21c1
Sequence:CCGGAGGATTCACCTGTTATCTTTGCTCGAGCAAAGATAACAGGTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145391.1-1085s21c1
Sequence:CCGGCTTACCCAACCTCACTCTAAACTCGAGTTTAGAGTGAGGTTGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145391.1-638s21c1
Sequence:CCGGCTGCGAGATCTCCAAGTATTTCTCGAGAAATACTTGGAGATCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145391.1-1654s21c1
Sequence:CCGGTCCACATCCTGGCTACTTAAACTCGAGTTTAAGTAGCCAGGATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks