EMAIL THIS PAGE TO A FRIEND

TAPT1-AS1

TAPT1 antisense RNA 1 (head to head)

Species: Human TAPT1-AS1(202020)
Gene ID:
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152684 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152684 Rosetta Predictions human pricing
XR_040405 Rosetta Predictions human pricing
XR_040406 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042042 predicted 1398
2 SASI_Hs01_00042043 predicted 1189
3 SASI_Hs01_00042044 predicted 1242
4 SASI_Hs01_00042045 predicted 1332
5 SASI_Hs01_00042046 predicted 975
6 SASI_Hs01_00042047 predicted 1307
7 SASI_Hs01_00042048 predicted 977
8 SASI_Hs01_00042049 predicted 1160
9 SASI_Hs01_00042050 predicted 575
10 SASI_Hs01_00042051 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518551 predicted 551
2 SASI_Hs02_00518552 predicted 486
3 SASI_Hs02_00518553 predicted 540
4 SASI_Hs02_00518554 predicted 537
5 SASI_Hs02_00518555 predicted 483
6 SASI_Hs02_00518556 predicted 538
7 SASI_Hs02_00518557 predicted 482
8 SASI_Hs02_00518558 predicted 492
9 SASI_Hs02_00518559 predicted 481
10 SASI_Hs02_00518560 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518561 predicted 549
2 SASI_Hs02_00518562 predicted 492
3 SASI_Hs02_00518563 predicted 540
4 SASI_Hs02_00518564 predicted 541
5 SASI_Hs02_00518565 predicted 486
6 SASI_Hs02_00518566 predicted 544
7 SASI_Hs02_00518567 predicted 484
8 SASI_Hs02_00518568 predicted 493
9 SASI_Hs02_00518569 predicted 485
10 SASI_Hs02_00518570 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152684
TAPT1-AS1 MISSION shRNA Bacterial Glycerol Stock
TAPT1 antisense RNA 1 (head to head)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152684.1-1156s1c1
Sequence:CCGGCCTCGTTGAAAGGAGGAACATCTCGAGATGTTCCTCCTTTCAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152684.1-460s1c1
Sequence:CCGGCTTTGGCAGTTTCCAAAGCATCTCGAGATGCTTTGGAAACTGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152684.1-416s1c1
Sequence:CCGGGCATATTTATGCTTGCCTGTTCTCGAGAACAGGCAAGCATAAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152684.1-642s1c1
Sequence:CCGGCTTACTTTGTCGCTTTACTTGCTCGAGCAAGTAAAGCGACAAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152684.1-641s1c1
Sequence:CCGGCCTTACTTTGTCGCTTTACTTCTCGAGAAGTAAAGCGACAAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152684.1-402s1c1
Sequence:CCGGGTTCCATCTCTTCTGCATATTCTCGAGAATATGCAGAAGAGATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152684.1-1615s1c1
Sequence:CCGGGCCAGTTGTCAGAATGGACTTCTCGAGAAGTCCATTCTGACAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152684
TAPT1-AS1 MISSION shRNA shRNA Plasmid DNA
TAPT1 antisense RNA 1 (head to head)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152684.1-1156s1c1
Sequence:CCGGCCTCGTTGAAAGGAGGAACATCTCGAGATGTTCCTCCTTTCAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152684.1-460s1c1
Sequence:CCGGCTTTGGCAGTTTCCAAAGCATCTCGAGATGCTTTGGAAACTGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152684.1-416s1c1
Sequence:CCGGGCATATTTATGCTTGCCTGTTCTCGAGAACAGGCAAGCATAAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152684.1-642s1c1
Sequence:CCGGCTTACTTTGTCGCTTTACTTGCTCGAGCAAGTAAAGCGACAAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152684.1-641s1c1
Sequence:CCGGCCTTACTTTGTCGCTTTACTTCTCGAGAAGTAAAGCGACAAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152684.1-402s1c1
Sequence:CCGGGTTCCATCTCTTCTGCATATTCTCGAGAATATGCAGAAGAGATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152684.1-1615s1c1
Sequence:CCGGGCCAGTTGTCAGAATGGACTTCTCGAGAAGTCCATTCTGACAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152684
TAPT1-AS1 MISSION shRNA Lentiviral Transduction Particles
TAPT1 antisense RNA 1 (head to head)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152684.1-1156s1c1
Sequence:CCGGCCTCGTTGAAAGGAGGAACATCTCGAGATGTTCCTCCTTTCAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152684.1-460s1c1
Sequence:CCGGCTTTGGCAGTTTCCAAAGCATCTCGAGATGCTTTGGAAACTGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152684.1-416s1c1
Sequence:CCGGGCATATTTATGCTTGCCTGTTCTCGAGAACAGGCAAGCATAAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152684.1-642s1c1
Sequence:CCGGCTTACTTTGTCGCTTTACTTGCTCGAGCAAGTAAAGCGACAAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152684.1-641s1c1
Sequence:CCGGCCTTACTTTGTCGCTTTACTTCTCGAGAAGTAAAGCGACAAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152684.1-402s1c1
Sequence:CCGGGTTCCATCTCTTCTGCATATTCTCGAGAATATGCAGAAGAGATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152684.1-1615s1c1
Sequence:CCGGGCCAGTTGTCAGAATGGACTTCTCGAGAAGTCCATTCTGACAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks