EMAIL THIS PAGE TO A FRIEND

TAPT1

transmembrane anterior posterior transformation 1

Synonyms: CMVFR
UniProtKB ID: Q6NXT6, Q8N2S3, Q9NZK9
Gene ID:
Human(202018) Summary: This gene encodes a highly conserved, putative transmembrane protein. A mutation in the mouse ortholog of this gene results in homeotic, posterior-to-anterior transformations of the axial skeleton which are similar to the phenotype of mouse homeobox C8 gene mutants. This gene is proposed to function downstream of homeobox C8 to transduce extracellular patterning information during axial skeleton development. An alternatively spliced transcript variant encoding a substantially different isoform has been described, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(231225) transmembrane anterior posterior transformation 1
Rat(305386) transmembrane anterior posterior transformation 1
Zebrafish(559710) Transmembrane anterior posterior transformation protein 1 homolog-like
Horse(100068801) transmembrane anterior posterior transformation 1
domestic cat(101081135) transmembrane anterior posterior transformation 1
dog(488815) transmembrane anterior posterior transformation 1
chicken(422824) transmembrane anterior posterior transformation 1
cow(615598) transmembrane anterior posterior transformation 1
sheep(101107445) transmembrane anterior posterior transformation 1
naked mole-rat(101717174) transmembrane anterior posterior transformation 1
domestic guinea pig(100727093) transmembrane anterior posterior transformation 1
150 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153365 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153365 Rosetta Predictions human pricing
XM_001059604 Rosetta Predictions rat pricing
XM_223500 Rosetta Predictions rat pricing
NM_173764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ?
1 SASI_Hs01_00060294 predicted 1115
2 SASI_Hs01_00060295 predicted 1068
3 SASI_Hs01_00060296 predicted 1584
4 SASI_Hs01_00060297 predicted 1392
5 SASI_Hs01_00060298 predicted 986
6 SASI_Hs02_00367234 predicted 1441
7 SASI_Hs01_00060299 predicted 506
8 SASI_Hs01_00060300 predicted 660
9 SASI_Hs01_00060302 predicted 860
10 SASI_Hs01_00060303 predicted 1624
11 SASI_Hs01_00060301 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ?
1 SASI_Rn02_00293704 predicted 807
2 SASI_Rn02_00293705 predicted 1141
3 SASI_Rn02_00293706 predicted 1467
4 SASI_Rn02_00293707 predicted 791
5 SASI_Rn02_00293708 predicted 903
6 SASI_Rn02_00293709 predicted 1339
7 SASI_Rn02_00293710 predicted 823
8 SASI_Rn02_00293711 predicted 719
9 SASI_Rn02_00293712 predicted 1441
10 SASI_Rn02_00293713 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ?
1 SASI_Rn02_00381427 predicted 2013
2 SASI_Rn02_00381428 predicted 1348
3 SASI_Rn02_00381429 predicted 1461
4 SASI_Rn02_00381430 predicted 647
5 SASI_Rn02_00381431 predicted 1893
6 SASI_Rn02_00381432 predicted 1371
7 SASI_Rn02_00381433 predicted 1272
8 SASI_Rn02_00381434 predicted 551
9 SASI_Rn02_00381435 predicted 1102
10 SASI_Rn02_00381436 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ?
1 SASI_Mm01_00150170 predicted 1028
2 SASI_Mm01_00150172 predicted 902
3 SASI_Mm01_00150173 predicted 982
4 SASI_Mm01_00150174 predicted 623
5 SASI_Mm02_00345420 predicted 1089
6 SASI_Mm01_00150175 predicted 505
7 SASI_Mm01_00150176 predicted 1545
8 SASI_Mm01_00150177 predicted 1672
9 SASI_Mm01_00150178 predicted 1193
10 SASI_Mm01_00150179 predicted 1620
11 SASI_Mm01_00150171 predicted 1535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153365
VALIDATED
TAPT1 MISSION shRNA Bacterial Glycerol Stock
transmembrane anterior posterior transformation 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-1276s21c1
Sequence:CCGGGCACGGAGGATGGGCTTTATTCTCGAGAATAAAGCCCATCCTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-336s21c1
Sequence:CCGGACATAATGAGGCCAAGTATACCTCGAGGTATACTTGGCCTCATTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-1399s21c1
Sequence:CCGGATATCCCTGAAAGTACTTAATCTCGAGATTAAGTACTTTCAGGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-1123s21c1
Sequence:CCGGTCAGAAATTGCCGTGGATATTCTCGAGAATATCCACGGCAATTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-1586s21c1
Sequence:CCGGCCATCACCAAACAACCTATTCCTCGAGGAATAGGTTGTTTGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-373s21c1
Sequence:CCGGGTATACACTTGTTTGCGAATACTCGAGTATTCGCAAACAAGTGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-982s21c1
Sequence:CCGGCAAATGTCAAATAGCGATATTCTCGAGAATATCGCTATTTGACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153365.1-3120s1c1
Sequence:CCGGGCCACCGTGAATGGAATAGTTCTCGAGAACTATTCCATTCACGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_153365.1-545s1c1
Sequence:CCGGCTATGTTGACTACTCCATGATCTCGAGATCATGGAGTAGTCAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153365.1-2813s1c1
Sequence:CCGGGCGTACATACATAGGCAGAAACTCGAGTTTCTGCCTATGTATGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153365.1-3121s1c1
Sequence:CCGGCCACCGTGAATGGAATAGTTTCTCGAGAAACTATTCCATTCACGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153365.1-542s1c1
Sequence:CCGGGCACTATGTTGACTACTCCATCTCGAGATGGAGTAGTCAACATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153365
VALIDATED
TAPT1 MISSION shRNA shRNA Plasmid DNA
transmembrane anterior posterior transformation 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-1276s21c1
Sequence:CCGGGCACGGAGGATGGGCTTTATTCTCGAGAATAAAGCCCATCCTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-336s21c1
Sequence:CCGGACATAATGAGGCCAAGTATACCTCGAGGTATACTTGGCCTCATTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-1399s21c1
Sequence:CCGGATATCCCTGAAAGTACTTAATCTCGAGATTAAGTACTTTCAGGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-1123s21c1
Sequence:CCGGTCAGAAATTGCCGTGGATATTCTCGAGAATATCCACGGCAATTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-1586s21c1
Sequence:CCGGCCATCACCAAACAACCTATTCCTCGAGGAATAGGTTGTTTGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-373s21c1
Sequence:CCGGGTATACACTTGTTTGCGAATACTCGAGTATTCGCAAACAAGTGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-982s21c1
Sequence:CCGGCAAATGTCAAATAGCGATATTCTCGAGAATATCGCTATTTGACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153365.1-3120s1c1
Sequence:CCGGGCCACCGTGAATGGAATAGTTCTCGAGAACTATTCCATTCACGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_153365.1-545s1c1
Sequence:CCGGCTATGTTGACTACTCCATGATCTCGAGATCATGGAGTAGTCAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153365.1-2813s1c1
Sequence:CCGGGCGTACATACATAGGCAGAAACTCGAGTTTCTGCCTATGTATGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153365.1-3121s1c1
Sequence:CCGGCCACCGTGAATGGAATAGTTTCTCGAGAAACTATTCCATTCACGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153365.1-542s1c1
Sequence:CCGGGCACTATGTTGACTACTCCATCTCGAGATGGAGTAGTCAACATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153365
VALIDATED
TAPT1 MISSION shRNA Lentiviral Transduction Particles
transmembrane anterior posterior transformation 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-1276s21c1
Sequence:CCGGGCACGGAGGATGGGCTTTATTCTCGAGAATAAAGCCCATCCTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-336s21c1
Sequence:CCGGACATAATGAGGCCAAGTATACCTCGAGGTATACTTGGCCTCATTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-1399s21c1
Sequence:CCGGATATCCCTGAAAGTACTTAATCTCGAGATTAAGTACTTTCAGGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-1123s21c1
Sequence:CCGGTCAGAAATTGCCGTGGATATTCTCGAGAATATCCACGGCAATTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-1586s21c1
Sequence:CCGGCCATCACCAAACAACCTATTCCTCGAGGAATAGGTTGTTTGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-373s21c1
Sequence:CCGGGTATACACTTGTTTGCGAATACTCGAGTATTCGCAAACAAGTGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153365.2-982s21c1
Sequence:CCGGCAAATGTCAAATAGCGATATTCTCGAGAATATCGCTATTTGACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153365.1-3120s1c1
Sequence:CCGGGCCACCGTGAATGGAATAGTTCTCGAGAACTATTCCATTCACGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_153365.1-545s1c1
Sequence:CCGGCTATGTTGACTACTCCATGATCTCGAGATCATGGAGTAGTCAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153365.1-2813s1c1
Sequence:CCGGGCGTACATACATAGGCAGAAACTCGAGTTTCTGCCTATGTATGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153365.1-3121s1c1
Sequence:CCGGCCACCGTGAATGGAATAGTTTCTCGAGAAACTATTCCATTCACGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153365.1-542s1c1
Sequence:CCGGGCACTATGTTGACTACTCCATCTCGAGATGGAGTAGTCAACATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173764
VALIDATED
TAPT1 MISSION shRNA Bacterial Glycerol Stock
transmembrane anterior posterior transformation 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173764.2-464s1c1
Sequence:CCGGGCTGTCTTACTCATCAGAGTTCTCGAGAACTCTGATGAGTAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173764.2-1531s1c1
Sequence:CCGGGCCCAGTCATTTACTTTATAACTCGAGTTATAAAGTAAATGACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173764.2-276s1c1
Sequence:CCGGCATCCGAAATTGCTGTGGATACTCGAGTATCCACAGCAATTTCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173764.2-2022s1c1
Sequence:CCGGCCTGCTTCATTACTACCTATTCTCGAGAATAGGTAGTAATGAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173764
VALIDATED
TAPT1 MISSION shRNA shRNA Plasmid DNA
transmembrane anterior posterior transformation 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173764.2-464s1c1
Sequence:CCGGGCTGTCTTACTCATCAGAGTTCTCGAGAACTCTGATGAGTAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173764.2-1531s1c1
Sequence:CCGGGCCCAGTCATTTACTTTATAACTCGAGTTATAAAGTAAATGACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173764.2-276s1c1
Sequence:CCGGCATCCGAAATTGCTGTGGATACTCGAGTATCCACAGCAATTTCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173764.2-2022s1c1
Sequence:CCGGCCTGCTTCATTACTACCTATTCTCGAGAATAGGTAGTAATGAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173764
VALIDATED
TAPT1 MISSION shRNA Lentiviral Transduction Particles
transmembrane anterior posterior transformation 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173764.2-464s1c1
Sequence:CCGGGCTGTCTTACTCATCAGAGTTCTCGAGAACTCTGATGAGTAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173764.2-1531s1c1
Sequence:CCGGGCCCAGTCATTTACTTTATAACTCGAGTTATAAAGTAAATGACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173764.2-276s1c1
Sequence:CCGGCATCCGAAATTGCTGTGGATACTCGAGTATCCACAGCAATTTCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173764.2-2022s1c1
Sequence:CCGGCCTGCTTCATTACTACCTATTCTCGAGAATAGGTAGTAATGAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks