EMAIL THIS PAGE TO A FRIEND

TARBP1

TAR (HIV-1) RNA binding protein 1

Synonyms: TRM3 TRP-185 TRP185
UniProtKB ID: Q13395, Q9H581
Gene ID:
Human(6894) Summary: HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
chicken(421517) Tar (HIV-1) RNA binding protein 1
dog(479200) TAR (HIV-1) RNA binding protein 1
domestic cat(101087009) TAR (HIV-1) RNA binding protein 1
Horse(100059375) TAR (HIV-1) RNA binding protein 1
domestic guinea pig(100729381) TAR (HIV-1) RNA binding protein 1
naked mole-rat(101701527) TAR (HIV-1) RNA binding protein 1
Domestic Rabbit(100354054) TAR (HIV-1) RNA binding protein 1
cow(535018) TAR (HIV-1) RNA binding protein 1
sheep(101116202) TAR (HIV-1) RNA binding protein 1
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005646 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027861 MISSION® esiRNA esiRNA human TARBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005646 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340002 predicted 2404
2 SASI_Hs01_00169143 predicted 2732
3 SASI_Hs01_00169144 predicted 3381
4 SASI_Hs01_00169146 predicted 2882
5 SASI_Hs01_00169148 predicted 3287
6 SASI_Hs02_00340003 predicted 4180
7 SASI_Hs01_00169150 predicted 2204
8 SASI_Hs01_00169151 predicted 3989
9 SASI_Hs02_00340004 predicted 3224
10 SASI_Hs01_00169152 predicted 1668
11 SASI_Hs01_00169145 predicted 4113
12 SASI_Hs01_00169147 predicted 2954
13 SASI_Hs01_00169149 predicted 1818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005646
VALIDATED
TARBP1 MISSION shRNA Bacterial Glycerol Stock
TAR (HIV-1) RNA binding protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005646.2-1990s1c1
Sequence:CCGGCGGATATTCTTAGACCCTCTTCTCGAGAAGAGGGTCTAAGAATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005646.2-3602s1c1
Sequence:CCGGCCAACAATCAAGCATCCATAACTCGAGTTATGGATGCTTGATTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005646.2-4616s1c1
Sequence:CCGGCCATCATTGGAGTGGAACAAACTCGAGTTTGTTCCACTCCAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005646.2-3302s1c1
Sequence:CCGGCGGCAAATATTGTTATGGAAACTCGAGTTTCCATAACAATATTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005646.2-2126s1c1
Sequence:CCGGCCCAAGATGATGAGGTGTCTACTCGAGTAGACACCTCATCATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005646.3-2126s21c1
Sequence:CCGGCCCAAGATGATGAGGTGTCTACTCGAGTAGACACCTCATCATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005646.3-3602s21c1
Sequence:CCGGCCAACAATCAAGCATCCATAACTCGAGTTATGGATGCTTGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005646.3-4616s21c1
Sequence:CCGGCCATCATTGGAGTGGAACAAACTCGAGTTTGTTCCACTCCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005646.3-1990s21c1
Sequence:CCGGCGGATATTCTTAGACCCTCTTCTCGAGAAGAGGGTCTAAGAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005646
VALIDATED
TARBP1 MISSION shRNA shRNA Plasmid DNA
TAR (HIV-1) RNA binding protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005646.2-1990s1c1
Sequence:CCGGCGGATATTCTTAGACCCTCTTCTCGAGAAGAGGGTCTAAGAATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005646.2-3602s1c1
Sequence:CCGGCCAACAATCAAGCATCCATAACTCGAGTTATGGATGCTTGATTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005646.2-4616s1c1
Sequence:CCGGCCATCATTGGAGTGGAACAAACTCGAGTTTGTTCCACTCCAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005646.2-3302s1c1
Sequence:CCGGCGGCAAATATTGTTATGGAAACTCGAGTTTCCATAACAATATTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005646.2-2126s1c1
Sequence:CCGGCCCAAGATGATGAGGTGTCTACTCGAGTAGACACCTCATCATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005646.3-2126s21c1
Sequence:CCGGCCCAAGATGATGAGGTGTCTACTCGAGTAGACACCTCATCATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005646.3-3602s21c1
Sequence:CCGGCCAACAATCAAGCATCCATAACTCGAGTTATGGATGCTTGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005646.3-4616s21c1
Sequence:CCGGCCATCATTGGAGTGGAACAAACTCGAGTTTGTTCCACTCCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005646.3-1990s21c1
Sequence:CCGGCGGATATTCTTAGACCCTCTTCTCGAGAAGAGGGTCTAAGAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005646
VALIDATED
TARBP1 MISSION shRNA Lentiviral Transduction Particles
TAR (HIV-1) RNA binding protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005646.2-1990s1c1
Sequence:CCGGCGGATATTCTTAGACCCTCTTCTCGAGAAGAGGGTCTAAGAATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005646.2-3602s1c1
Sequence:CCGGCCAACAATCAAGCATCCATAACTCGAGTTATGGATGCTTGATTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005646.2-4616s1c1
Sequence:CCGGCCATCATTGGAGTGGAACAAACTCGAGTTTGTTCCACTCCAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005646.2-3302s1c1
Sequence:CCGGCGGCAAATATTGTTATGGAAACTCGAGTTTCCATAACAATATTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005646.2-2126s1c1
Sequence:CCGGCCCAAGATGATGAGGTGTCTACTCGAGTAGACACCTCATCATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005646.3-2126s21c1
Sequence:CCGGCCCAAGATGATGAGGTGTCTACTCGAGTAGACACCTCATCATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005646.3-3602s21c1
Sequence:CCGGCCAACAATCAAGCATCCATAACTCGAGTTATGGATGCTTGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005646.3-4616s21c1
Sequence:CCGGCCATCATTGGAGTGGAACAAACTCGAGTTTGTTCCACTCCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005646.3-1990s21c1
Sequence:CCGGCGGATATTCTTAGACCCTCTTCTCGAGAAGAGGGTCTAAGAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks