EMAIL THIS PAGE TO A FRIEND

TARBP2

TAR (HIV-1) RNA binding protein 2

Synonyms: LOQS TRBP TRBP1 TRBP2
UniProtKB ID: Q15633, Q12878, Q8WY32, Q8WY33, Q9BRY2
Gene ID:
Human(6895) Summary: HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. The protein encoded by this gene binds between the bulge and the loop of the HIV-1 TAR RNA regulatory element and activates HIV-1 gene expression in synergy with the viral Tat protein. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene also has a pseudogene. [provided by RefSeq, Jul 2008]
Mouse(21357) TAR (HIV) RNA binding protein 2
Rat(363006) TAR (HIV-1) RNA binding protein 2
cow(514674) TAR (HIV-1) RNA binding protein 2
sheep(101102467) TAR (HIV-1) RNA binding protein 2
naked mole-rat(101701286) TAR (HIV-1) RNA binding protein 2
domestic guinea pig(100731044) TAR (HIV-1) RNA binding protein 2
Zebrafish(336141) TAR (HIV) RNA binding protein 2
domestic cat(101087415) TAR (HIV-1) RNA binding protein 2
dog(100684088) TAR (HIV-1) RNA binding protein 2
222 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004178 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154801 MISSION® esiRNA esiRNA human TARBP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004178 Rosetta Predictions human pricing
NM_134323 Rosetta Predictions human pricing
NM_134324 Rosetta Predictions human pricing
NM_001034941 Rosetta Predictions rat pricing
NM_009319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171749 predicted 1017
2 SASI_Hs01_00171750 predicted 606
3 SASI_Hs01_00171751 predicted 813
4 SASI_Hs01_00171752 predicted 938
5 SASI_Hs01_00171753 predicted 803
6 SASI_Hs01_00171754 predicted 580
7 SASI_Hs01_00171755 predicted 937
8 SASI_Hs01_00171756 predicted 655
9 SASI_Hs01_00171757 predicted 543
10 SASI_Hs01_00171758 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158284 predicted 1483
2 SASI_Hs01_00158285 predicted 1075
3 SASI_Hs01_00158286 predicted 1276
4 SASI_Hs01_00158287 predicted 1400
5 SASI_Hs01_00158288 predicted 1267
6 SASI_Hs01_00158289 predicted 1051
7 SASI_Hs01_00158290 predicted 1397
8 SASI_Hs01_00158291 predicted 1126
9 SASI_Hs01_00158292 predicted 1011
10 SASI_Hs01_00158293 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093725 predicted 1056
2 SASI_Hs01_00093726 predicted 650
3 SASI_Hs01_00093727 predicted 849
4 SASI_Hs01_00093728 predicted 983
5 SASI_Hs01_00093729 predicted 840
6 SASI_Hs01_00093730 predicted 625
7 SASI_Hs01_00093731 predicted 974
8 SASI_Hs01_00093732 predicted 702
9 SASI_Hs01_00093733 predicted 585
10 SASI_Hs01_00093734 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122095 predicted 1172
2 SASI_Rn01_00122096 predicted 1172
3 SASI_Rn01_00122097 predicted 760
4 SASI_Rn01_00122099 predicted 1048
5 SASI_Rn01_00122100 predicted 798
6 SASI_Rn02_00204126 predicted 661
7 SASI_Rn01_00122101 predicted 1102
8 SASI_Rn01_00122102 predicted 803
9 SASI_Rn02_00204127 predicted 604
10 SASI_Rn01_00122104 predicted 798
11 SASI_Rn01_00122098 predicted 1246
12 SASI_Rn01_00122103 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138710 predicted 1349
2 SASI_Mm02_00315864 predicted 1302
3 SASI_Mm01_00138711 predicted 1375
4 SASI_Mm01_00138712 predicted 966
5 SASI_Mm01_00138714 predicted 558
6 SASI_Mm01_00138717 predicted 1506
7 SASI_Mm01_00138718 predicted 1358
8 SASI_Mm01_00138719 predicted 1213
9 SASI_Mm02_00315865 predicted 1413
10 SASI_Mm02_00315866 predicted 1103
11 SASI_Mm01_00138713 predicted 229
12 SASI_Mm01_00138715 predicted 843
13 SASI_Mm01_00138716 predicted 302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009319
VALIDATED
TARBP2 MISSION shRNA Bacterial Glycerol Stock
TAR (HIV-1) RNA binding protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009319.2-866s21c1
Sequence:CCGGCGCAAAGAGTTCACCATGACTCTCGAGAGTCATGGTGAACTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009319.2-1014s21c1
Sequence:CCGGCAGAGCCTGATGACGATCATTCTCGAGAATGATCGTCATCAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009319.2-468s21c1
Sequence:CCGGGCCAAGCCCATCAACCTAATTCTCGAGAATTAGGTTGATGGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009319.2-1412s21c1
Sequence:CCGGGCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009319.1-1199s1c1
Sequence:CCGGGCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009319.1-654s1c1
Sequence:CCGGGCAAAGAGTTCACCATGACTTCTCGAGAAGTCATGGTGAACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009319.1-653s1c1
Sequence:CCGGCGCAAAGAGTTCACCATGACTCTCGAGAGTCATGGTGAACTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009319.1-801s1c1
Sequence:CCGGCAGAGCCTGATGACGATCATTCTCGAGAATGATCGTCATCAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009319
VALIDATED
TARBP2 MISSION shRNA shRNA Plasmid DNA
TAR (HIV-1) RNA binding protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009319.2-866s21c1
Sequence:CCGGCGCAAAGAGTTCACCATGACTCTCGAGAGTCATGGTGAACTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009319.2-1014s21c1
Sequence:CCGGCAGAGCCTGATGACGATCATTCTCGAGAATGATCGTCATCAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009319.2-468s21c1
Sequence:CCGGGCCAAGCCCATCAACCTAATTCTCGAGAATTAGGTTGATGGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009319.2-1412s21c1
Sequence:CCGGGCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009319.1-1199s1c1
Sequence:CCGGGCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009319.1-654s1c1
Sequence:CCGGGCAAAGAGTTCACCATGACTTCTCGAGAAGTCATGGTGAACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009319.1-653s1c1
Sequence:CCGGCGCAAAGAGTTCACCATGACTCTCGAGAGTCATGGTGAACTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009319.1-801s1c1
Sequence:CCGGCAGAGCCTGATGACGATCATTCTCGAGAATGATCGTCATCAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009319
VALIDATED
TARBP2 MISSION shRNA Lentiviral Transduction Particles
TAR (HIV-1) RNA binding protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009319.2-866s21c1
Sequence:CCGGCGCAAAGAGTTCACCATGACTCTCGAGAGTCATGGTGAACTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009319.2-1014s21c1
Sequence:CCGGCAGAGCCTGATGACGATCATTCTCGAGAATGATCGTCATCAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009319.2-468s21c1
Sequence:CCGGGCCAAGCCCATCAACCTAATTCTCGAGAATTAGGTTGATGGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009319.2-1412s21c1
Sequence:CCGGGCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009319.1-1199s1c1
Sequence:CCGGGCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009319.1-654s1c1
Sequence:CCGGGCAAAGAGTTCACCATGACTTCTCGAGAAGTCATGGTGAACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009319.1-653s1c1
Sequence:CCGGCGCAAAGAGTTCACCATGACTCTCGAGAGTCATGGTGAACTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009319.1-801s1c1
Sequence:CCGGCAGAGCCTGATGACGATCATTCTCGAGAATGATCGTCATCAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004178
TARBP2 MISSION shRNA Bacterial Glycerol Stock
TAR (HIV-1) RNA binding protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004178.4-615s21c1
Sequence:CCGGGTGGAGCGTTTCATTGAGATTCTCGAGAATCTCAATGAAACGCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004178.4-945s21c1
Sequence:CCGGCACGTCAGCTACCTGGATATTCTCGAGAATATCCAGGTAGCTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004178.4-1138s21c1
Sequence:CCGGCTCATGGATGTGCACCCTTTGCTCGAGCAAAGGGTGCACATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004178.4-188s21c1
Sequence:CCGGCCAAGCCCACCAGCCTAATTTCTCGAGAAATTAGGCTGGTGGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004178.4-814s21c1
Sequence:CCGGCCTGGGATTCTCTACGAAATTCTCGAGAATTTCGTAGAGAATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004178.3-913s1c1
Sequence:CCGGCACGTCAGCTACCTGGATATTCTCGAGAATATCCAGGTAGCTGACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004178.3-782s1c1
Sequence:CCGGCCTGGGATTCTCTACGAAATTCTCGAGAATTTCGTAGAGAATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004178.3-162s1c1
Sequence:CCGGCCACCAGCCTAATTTCACCTTCTCGAGAAGGTGAAATTAGGCTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004178.3-583s1c1
Sequence:CCGGGTGGAGCGTTTCATTGAGATTCTCGAGAATCTCAATGAAACGCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004178
TARBP2 MISSION shRNA shRNA Plasmid DNA
TAR (HIV-1) RNA binding protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004178.4-615s21c1
Sequence:CCGGGTGGAGCGTTTCATTGAGATTCTCGAGAATCTCAATGAAACGCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004178.4-945s21c1
Sequence:CCGGCACGTCAGCTACCTGGATATTCTCGAGAATATCCAGGTAGCTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004178.4-1138s21c1
Sequence:CCGGCTCATGGATGTGCACCCTTTGCTCGAGCAAAGGGTGCACATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004178.4-188s21c1
Sequence:CCGGCCAAGCCCACCAGCCTAATTTCTCGAGAAATTAGGCTGGTGGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004178.4-814s21c1
Sequence:CCGGCCTGGGATTCTCTACGAAATTCTCGAGAATTTCGTAGAGAATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004178.3-913s1c1
Sequence:CCGGCACGTCAGCTACCTGGATATTCTCGAGAATATCCAGGTAGCTGACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004178.3-782s1c1
Sequence:CCGGCCTGGGATTCTCTACGAAATTCTCGAGAATTTCGTAGAGAATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004178.3-162s1c1
Sequence:CCGGCCACCAGCCTAATTTCACCTTCTCGAGAAGGTGAAATTAGGCTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004178.3-583s1c1
Sequence:CCGGGTGGAGCGTTTCATTGAGATTCTCGAGAATCTCAATGAAACGCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004178
TARBP2 MISSION shRNA Lentiviral Transduction Particles
TAR (HIV-1) RNA binding protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004178.4-615s21c1
Sequence:CCGGGTGGAGCGTTTCATTGAGATTCTCGAGAATCTCAATGAAACGCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004178.4-945s21c1
Sequence:CCGGCACGTCAGCTACCTGGATATTCTCGAGAATATCCAGGTAGCTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004178.4-1138s21c1
Sequence:CCGGCTCATGGATGTGCACCCTTTGCTCGAGCAAAGGGTGCACATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004178.4-188s21c1
Sequence:CCGGCCAAGCCCACCAGCCTAATTTCTCGAGAAATTAGGCTGGTGGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004178.4-814s21c1
Sequence:CCGGCCTGGGATTCTCTACGAAATTCTCGAGAATTTCGTAGAGAATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004178.3-913s1c1
Sequence:CCGGCACGTCAGCTACCTGGATATTCTCGAGAATATCCAGGTAGCTGACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004178.3-782s1c1
Sequence:CCGGCCTGGGATTCTCTACGAAATTCTCGAGAATTTCGTAGAGAATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004178.3-162s1c1
Sequence:CCGGCCACCAGCCTAATTTCACCTTCTCGAGAAGGTGAAATTAGGCTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004178.3-583s1c1
Sequence:CCGGGTGGAGCGTTTCATTGAGATTCTCGAGAATCTCAATGAAACGCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks