EMAIL THIS PAGE TO A FRIEND

TARDBP

TAR DNA binding protein

Synonyms: ALS10 TDP-43
Gene ID:
Human(23435) Summary: HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. The protein encoded by this gene is a transcriptional repressor that binds to chromosomally integrated TAR DNA and represses HIV-1 transcription. In addition, this protein regulates alternate splicing of the CFTR gene. A similar pseudogene is present on chromosome 20. [provided by RefSeq, Jul 2008]
Mouse(230908) TAR DNA binding protein
Rat(298648) TAR DNA binding protein
Zebrafish(325052) TAR DNA binding protein
Horse(100051482) TAR DNA binding protein
domestic cat(101097257) TAR DNA binding protein
dog(478234) TAR DNA binding protein
chicken(419453) TAR DNA binding protein
cow(540632) TAR DNA binding protein
sheep(101114038) TAR DNA binding protein
domestic guinea pig(100718595) TAR DNA binding protein
naked mole-rat(101697585) TAR DNA binding protein
Gene Class: Cytoskeleton
303 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200225 Anti-diphospho-TDP-43 [pSer409, pSer410] antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, antigen mol wt ~43 kDa mouse, human
western blot pricing
SAB4200411 Anti-non-phospho-TDP-43 antibody produced in rabbit IgG fraction of antiserum mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200224 Anti-phospho-TDP-43 (pSer410) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, mouse
western blot pricing
SAB4200223 Anti-phospho-TDP-43 [pSer409] antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse, human
immunofluorescence, western blot pricing
SAB2102371 Anti-TARDBP (ab1) antibody produced in rabbit affinity isolated antibody , human, mouse, rat, rabbit, canine, bovine, zebrafish, guinea pig, horse
western blot pricing
AV38941 Anti-TARDBP (AB1) antibody produced in rabbit IgG fraction of antiserum bovine, human, mouse, guinea pig, horse, rat, canine
immunohistochemistry, western blot pricing
SAB2102372 Anti-TARDBP (ab2) antibody produced in rabbit affinity isolated antibody human, rat, canine, mouse, guinea pig, horse
western blot pricing
AV38942 Anti-TARDBP (AB2) antibody produced in rabbit IgG fraction of antiserum horse, canine, mouse, guinea pig, rat, human
immunohistochemistry, western blot pricing
SAB2501017 Anti-TARDBP antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2701655 Anti-tardbp antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
HPA017284 Anti-TARDBP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
T1580 Anti-TDP-43 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200006 Anti-TDP-43 (N-terminal region) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
T1705 Anti-TDP-43 antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500236 Anti-TDP43 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
WH0023435M1 Monoclonal Anti-TARDBP antibody produced in mouse clone 2E2-D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404973 Monoclonal Anti-TARDBP antibody produced in mouse clone 1B4-B1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007375 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109221 MISSION® esiRNA esiRNA human TARDBP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007375 Rosetta Predictions human pricing
NM_001011979 Rosetta Predictions rat pricing
XM_575959 Rosetta Predictions rat pricing
NM_001003898 Rosetta Predictions mouse pricing
NM_001003899 Rosetta Predictions mouse pricing
NM_001008545 Rosetta Predictions mouse pricing
NM_001008546 Rosetta Predictions mouse pricing
NM_145556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037054 predicted 832
2 SASI_Hs01_00037055 predicted 662
3 SASI_Hs01_00037056 predicted 1429
4 SASI_Hs01_00037057 predicted 1028
5 SASI_Hs01_00037058 predicted 983
6 SASI_Hs01_00037060 predicted 836
7 SASI_Hs01_00037061 predicted 542
8 SASI_Hs01_00037062 predicted 337
9 SASI_Hs01_00037063 predicted 1393
10 SASI_Hs02_00343509 predicted 770
11 SASI_Hs01_00037059 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056874 predicted 540
2 SASI_Rn01_00056876 predicted 947
3 SASI_Rn01_00056877 predicted 954
4 SASI_Rn01_00056878 predicted 995
5 SASI_Rn01_00056879 predicted 875
6 SASI_Rn01_00056880 predicted 483
7 SASI_Rn01_00056881 predicted 613
8 SASI_Rn01_00056882 predicted 702
9 SASI_Rn01_00056883 predicted 804
10 SASI_Rn02_00200004 predicted 658
11 SASI_Rn01_00056875 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00128074 predicted 389
2 SASI_Rn01_00128075 predicted 520
3 SASI_Rn01_00128076 predicted 524
4 SASI_Rn01_00128077 predicted 663
5 SASI_Rn01_00128078 predicted 604
6 SASI_Rn01_00128079 predicted 488
7 SASI_Rn01_00128080 predicted 471
8 SASI_Rn01_00128081 predicted 689
9 SASI_Rn01_00128082 predicted 538
10 SASI_Rn01_00128083 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077185 predicted 847
2 SASI_Mm01_00077186 predicted 900
3 SASI_Mm01_00077188 predicted 712
4 SASI_Mm01_00077189 predicted 361
5 SASI_Mm02_00286342 predicted 465
6 SASI_Mm01_00077190 predicted 529
7 SASI_Mm01_00077191 predicted 459
8 SASI_Mm01_00077192 predicted 806
9 SASI_Mm01_00077193 predicted 681
10 SASI_Mm01_00077194 predicted 908
11 SASI_Mm01_00077187 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198818 predicted 847
2 SASI_Mm01_00198819 predicted 897
3 SASI_Mm01_00198821 predicted 717
4 SASI_Mm01_00198822 predicted 359
5 SASI_Mm02_00286343 predicted 465
6 SASI_Mm01_00198823 predicted 535
7 SASI_Mm01_00198824 predicted 454
8 SASI_Mm01_00198825 predicted 807
9 SASI_Mm01_00198826 predicted 679
10 SASI_Mm01_00198827 predicted 902
11 SASI_Mm01_00198820 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145156 predicted 847
2 SASI_Mm01_00145157 predicted 896
3 SASI_Mm01_00145159 predicted 715
4 SASI_Mm01_00145160 predicted 362
5 SASI_Mm02_00286819 predicted 470
6 SASI_Mm01_00145161 predicted 530
7 SASI_Mm01_00145162 predicted 452
8 SASI_Mm01_00145163 predicted 810
9 SASI_Mm01_00145164 predicted 676
10 SASI_Mm01_00145165 predicted 905
11 SASI_Mm01_00145158 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103736 predicted 843
2 SASI_Mm01_00103737 predicted 898
3 SASI_Mm01_00103739 predicted 716
4 SASI_Mm01_00103740 predicted 363
5 SASI_Mm02_00286820 predicted 468
6 SASI_Mm01_00103741 predicted 535
7 SASI_Mm01_00103742 predicted 459
8 SASI_Mm01_00103743 predicted 806
9 SASI_Mm01_00103744 predicted 684
10 SASI_Mm01_00103745 predicted 901
11 SASI_Mm01_00103738 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145126 predicted 850
2 SASI_Mm01_00145127 predicted 898
3 SASI_Mm01_00145129 predicted 712
4 SASI_Mm01_00145130 predicted 361
5 SASI_Mm02_00341053 predicted 465
6 SASI_Mm01_00145131 predicted 531
7 SASI_Mm01_00145132 predicted 454
8 SASI_Mm01_00145133 predicted 810
9 SASI_Mm01_00145134 predicted 678
10 SASI_Mm01_00145135 predicted 900
11 SASI_Mm01_00145128 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145556
VALIDATED
TARDBP MISSION shRNA Bacterial Glycerol Stock
TAR DNA binding protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000175828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145556.2-752s1c1
Sequence:CCGGGTAGATGTCTTCATTCCCAAACTCGAGTTTGGGAATGAAGACATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145556.2-543s1c1
Sequence:CCGGGCTTTGTTCGATTTACAGAATCTCGAGATTCTGTAAATCGAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145556.2-3178s1c1
Sequence:CCGGGCAGAGCATATCAATGGGAAACTCGAGTTTCCCATTGATATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145556.2-560s1c1
Sequence:CCGGGAATATGAAACCCAAGTGAAACTCGAGTTTCACTTGGGTTTCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145556
VALIDATED
TARDBP MISSION shRNA shRNA Plasmid DNA
TAR DNA binding protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000175828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145556.2-752s1c1
Sequence:CCGGGTAGATGTCTTCATTCCCAAACTCGAGTTTGGGAATGAAGACATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145556.2-543s1c1
Sequence:CCGGGCTTTGTTCGATTTACAGAATCTCGAGATTCTGTAAATCGAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145556.2-3178s1c1
Sequence:CCGGGCAGAGCATATCAATGGGAAACTCGAGTTTCCCATTGATATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145556.2-560s1c1
Sequence:CCGGGAATATGAAACCCAAGTGAAACTCGAGTTTCACTTGGGTTTCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145556
VALIDATED
TARDBP MISSION shRNA Lentiviral Transduction Particles
TAR DNA binding protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000175828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145556.2-752s1c1
Sequence:CCGGGTAGATGTCTTCATTCCCAAACTCGAGTTTGGGAATGAAGACATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145556.2-543s1c1
Sequence:CCGGGCTTTGTTCGATTTACAGAATCTCGAGATTCTGTAAATCGAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145556.2-3178s1c1
Sequence:CCGGGCAGAGCATATCAATGGGAAACTCGAGTTTCCCATTGATATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145556.2-560s1c1
Sequence:CCGGGAATATGAAACCCAAGTGAAACTCGAGTTTCACTTGGGTTTCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007375
VALIDATED
TARDBP MISSION shRNA Bacterial Glycerol Stock
TAR DNA binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007375.3-1261s1c1
Sequence:CCGGGCTCTAATTCTGGTGCAGCAACTCGAGTTGCTGCACCAGAATTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007375.3-177s1c1
Sequence:CCGGCCCATTGAAATACCATCGGAACTCGAGTTCCGATGGTATTTCAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007375.3-931s1c1
Sequence:CCGGGCAATAGACAGTTAGAAAGAACTCGAGTTCTTTCTAACTGTCTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007375.3-1333s1c1
Sequence:CCGGGCTTTGGCTCAAGCATGGATTCTCGAGAATCCATGCTTGAGCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007375.3-666s1c1
Sequence:CCGGCCTAATTCTAAGCAAAGCCAACTCGAGTTGGCTTTGCTTAGAATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007375.3-1333s21c1
Sequence:CCGGGCTTTGGCTCAAGCATGGATTCTCGAGAATCCATGCTTGAGCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007375.3-1429s21c1
Sequence:CCGGTCTAAACTCATGGTAAGTATACTCGAGTATACTTACCATGAGTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007375.3-1032s21c1
Sequence:CCGGGGAAACAATCAAGGTAGTAATCTCGAGATTACTACCTTGATTGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007375.3-545s21c1
Sequence:CCGGAGATCTTAAGACTGGTCATTCCTCGAGGAATGACCAGTCTTAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007375.3-1261s21c1
Sequence:CCGGGCTCTAATTCTGGTGCAGCAACTCGAGTTGCTGCACCAGAATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007375
VALIDATED
TARDBP MISSION shRNA shRNA Plasmid DNA
TAR DNA binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007375.3-1261s1c1
Sequence:CCGGGCTCTAATTCTGGTGCAGCAACTCGAGTTGCTGCACCAGAATTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007375.3-177s1c1
Sequence:CCGGCCCATTGAAATACCATCGGAACTCGAGTTCCGATGGTATTTCAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007375.3-931s1c1
Sequence:CCGGGCAATAGACAGTTAGAAAGAACTCGAGTTCTTTCTAACTGTCTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007375.3-1333s1c1
Sequence:CCGGGCTTTGGCTCAAGCATGGATTCTCGAGAATCCATGCTTGAGCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007375.3-666s1c1
Sequence:CCGGCCTAATTCTAAGCAAAGCCAACTCGAGTTGGCTTTGCTTAGAATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007375.3-1333s21c1
Sequence:CCGGGCTTTGGCTCAAGCATGGATTCTCGAGAATCCATGCTTGAGCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007375.3-1429s21c1
Sequence:CCGGTCTAAACTCATGGTAAGTATACTCGAGTATACTTACCATGAGTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007375.3-1032s21c1
Sequence:CCGGGGAAACAATCAAGGTAGTAATCTCGAGATTACTACCTTGATTGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007375.3-545s21c1
Sequence:CCGGAGATCTTAAGACTGGTCATTCCTCGAGGAATGACCAGTCTTAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007375.3-1261s21c1
Sequence:CCGGGCTCTAATTCTGGTGCAGCAACTCGAGTTGCTGCACCAGAATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007375
VALIDATED
TARDBP MISSION shRNA Lentiviral Transduction Particles
TAR DNA binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007375.3-1261s1c1
Sequence:CCGGGCTCTAATTCTGGTGCAGCAACTCGAGTTGCTGCACCAGAATTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007375.3-177s1c1
Sequence:CCGGCCCATTGAAATACCATCGGAACTCGAGTTCCGATGGTATTTCAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007375.3-931s1c1
Sequence:CCGGGCAATAGACAGTTAGAAAGAACTCGAGTTCTTTCTAACTGTCTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007375.3-1333s1c1
Sequence:CCGGGCTTTGGCTCAAGCATGGATTCTCGAGAATCCATGCTTGAGCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007375.3-666s1c1
Sequence:CCGGCCTAATTCTAAGCAAAGCCAACTCGAGTTGGCTTTGCTTAGAATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007375.3-1333s21c1
Sequence:CCGGGCTTTGGCTCAAGCATGGATTCTCGAGAATCCATGCTTGAGCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007375.3-1429s21c1
Sequence:CCGGTCTAAACTCATGGTAAGTATACTCGAGTATACTTACCATGAGTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007375.3-1032s21c1
Sequence:CCGGGGAAACAATCAAGGTAGTAATCTCGAGATTACTACCTTGATTGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007375.3-545s21c1
Sequence:CCGGAGATCTTAAGACTGGTCATTCCTCGAGGAATGACCAGTCTTAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007375.3-1261s21c1
Sequence:CCGGGCTCTAATTCTGGTGCAGCAACTCGAGTTGCTGCACCAGAATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks