EMAIL THIS PAGE TO A FRIEND

TARM1

T cell-interacting, activating receptor on myeloid cells 1

Synonyms: OLT-2
UniProtKB ID: B6A8C7, B4DWY4
Gene ID:
Mouse(245126) T cell-interacting, activating receptor on myeloid cells 1
Rat(499065) T cell-interacting, activating receptor on myeloid cells 1
cow(527020) T cell-interacting, activating receptor on myeloid cells 1
sheep(101108598) T cell-interacting, activating receptor on myeloid cells 1
dog(100682969) T cell-interacting, activating receptor on myeloid cells 1
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177363 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177363 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177363 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001135686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001135686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001135686 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001127643 Rosetta Predictions human pricing
XM_001718727 Rosetta Predictions human pricing
XM_497642 Rosetta Predictions human pricing
XM_001066603 Rosetta Predictions rat pricing
XM_574346 Rosetta Predictions rat pricing
NM_177363 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001127643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00384083 predicted 334
2 SASI_Hs02_00384084 predicted 307
3 SASI_Hs02_00384085 predicted 349
4 SASI_Hs02_00384086 predicted 328
5 SASI_Hs02_00384087 predicted 428
6 SASI_Hs02_00384088 predicted 356
7 SASI_Hs02_00384089 predicted 344
8 SASI_Hs02_00384090 predicted 270
9 SASI_Hs02_00384091 predicted 277
10 SASI_Hs02_00384092 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00425896 predicted 332
2 SASI_Hs02_00425897 predicted 306
3 SASI_Hs02_00425898 predicted 351
4 SASI_Hs02_00425899 predicted 326
5 SASI_Hs02_00425900 predicted 431
6 SASI_Hs02_00425901 predicted 352
7 SASI_Hs02_00425902 predicted 339
8 SASI_Hs02_00425903 predicted 272
9 SASI_Hs02_00425904 predicted 268
10 SASI_Hs02_00425905 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_497642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480099 predicted 331
2 SASI_Hs02_00480100 predicted 306
3 SASI_Hs02_00480101 predicted 353
4 SASI_Hs02_00480102 predicted 329
5 SASI_Hs02_00480103 predicted 436
6 SASI_Hs02_00480104 predicted 360
7 SASI_Hs02_00480105 predicted 346
8 SASI_Hs02_00480106 predicted 279
9 SASI_Hs02_00480107 predicted 269
10 SASI_Hs02_00480108 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318106 predicted 1025
2 SASI_Rn02_00318107 predicted 426
3 SASI_Rn02_00318108 predicted 281
4 SASI_Rn02_00318109 predicted 712
5 SASI_Rn02_00318110 predicted 337
6 SASI_Rn02_00318111 predicted 900
7 SASI_Rn02_00318112 predicted 244
8 SASI_Rn02_00318113 predicted 1129
9 SASI_Rn02_00318114 predicted 542
10 SASI_Rn02_00318115 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401801 predicted 1150
2 SASI_Rn02_00401802 predicted 948
3 SASI_Rn02_00401803 predicted 965
4 SASI_Rn02_00401804 predicted 1156
5 SASI_Rn02_00401805 predicted 749
6 SASI_Rn02_00401806 predicted 1088
7 SASI_Rn02_00401807 predicted 817
8 SASI_Rn02_00401808 predicted 781
9 SASI_Rn02_00401809 predicted 1035
10 SASI_Rn02_00401810 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064678 predicted 360
2 SASI_Mm02_00347519 predicted 527
3 SASI_Mm01_00064679 predicted 574
4 SASI_Mm01_00064680 predicted 288
5 SASI_Mm02_00347520 predicted 723
6 SASI_Mm01_00064681 predicted 621
7 SASI_Mm01_00064682 predicted 366
8 SASI_Mm01_00064684 predicted 344
9 SASI_Mm01_00064685 predicted 208
10 SASI_Mm01_00064686 predicted 611
11 SASI_Mm01_00064683 predicted 314
12 SASI_Mm01_00064687 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177363
TARM1 MISSION shRNA Bacterial Glycerol Stock
T cell-interacting, activating receptor on myeloid cells 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177363.3-925s21c1
Sequence:CCGGGAGCGGCTGTCTCCAAATAAACTCGAGTTTATTTGGAGACAGCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177363.3-763s21c1
Sequence:CCGGGATCTTGCTGCCTCGACTTTCCTCGAGGAAAGTCGAGGCAGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-672s1c1
Sequence:CCGGGCTGTGTTTACTATCAGGCAACTCGAGTTGCCTGATAGTAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-553s1c1
Sequence:CCGGCGTAAAGTTTGCGTTACTGAACTCGAGTTCAGTAACGCAAACTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-375s1c1
Sequence:CCGGCCTGTGAATACTATAGCAAATCTCGAGATTTGCTATAGTATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-301s1c1
Sequence:CCGGGCCATATAATTTGACAGAGGACTCGAGTCCTCTGTCAAATTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-216s1c1
Sequence:CCGGGCCACGTGACAATGCAATGTACTCGAGTACATTGCATTGTCACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177363
TARM1 MISSION shRNA shRNA Plasmid DNA
T cell-interacting, activating receptor on myeloid cells 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177363.3-925s21c1
Sequence:CCGGGAGCGGCTGTCTCCAAATAAACTCGAGTTTATTTGGAGACAGCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177363.3-763s21c1
Sequence:CCGGGATCTTGCTGCCTCGACTTTCCTCGAGGAAAGTCGAGGCAGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-672s1c1
Sequence:CCGGGCTGTGTTTACTATCAGGCAACTCGAGTTGCCTGATAGTAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-553s1c1
Sequence:CCGGCGTAAAGTTTGCGTTACTGAACTCGAGTTCAGTAACGCAAACTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-375s1c1
Sequence:CCGGCCTGTGAATACTATAGCAAATCTCGAGATTTGCTATAGTATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-301s1c1
Sequence:CCGGGCCATATAATTTGACAGAGGACTCGAGTCCTCTGTCAAATTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-216s1c1
Sequence:CCGGGCCACGTGACAATGCAATGTACTCGAGTACATTGCATTGTCACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177363
TARM1 MISSION shRNA Lentiviral Transduction Particles
T cell-interacting, activating receptor on myeloid cells 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177363.3-925s21c1
Sequence:CCGGGAGCGGCTGTCTCCAAATAAACTCGAGTTTATTTGGAGACAGCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177363.3-763s21c1
Sequence:CCGGGATCTTGCTGCCTCGACTTTCCTCGAGGAAAGTCGAGGCAGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-672s1c1
Sequence:CCGGGCTGTGTTTACTATCAGGCAACTCGAGTTGCCTGATAGTAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-553s1c1
Sequence:CCGGCGTAAAGTTTGCGTTACTGAACTCGAGTTCAGTAACGCAAACTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-375s1c1
Sequence:CCGGCCTGTGAATACTATAGCAAATCTCGAGATTTGCTATAGTATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-301s1c1
Sequence:CCGGGCCATATAATTTGACAGAGGACTCGAGTCCTCTGTCAAATTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177363.2-216s1c1
Sequence:CCGGGCCACGTGACAATGCAATGTACTCGAGTACATTGCATTGTCACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001135686
TARM1 MISSION shRNA Bacterial Glycerol Stock
T cell-interacting, activating receptor on myeloid cells 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-203s21c1
Sequence:CCGGCTCAGGAAGGGAGGAATTATTCTCGAGAATAATTCCTCCCTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-375s21c1
Sequence:CCGGTGTTGGTGACAGGACATTTATCTCGAGATAAATGTCCTGTCACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-654s21c1
Sequence:CCGGCCAGTGATCAGCTTGAGATATCTCGAGATATCTCAAGCTGATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-263s21c1
Sequence:CCGGGCCGAATTTCACCTCAATAATCTCGAGATTATTGAGGTGAAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-460s21c1
Sequence:CCGGGTGCCAGAAGCGAGACCAATTCTCGAGAATTGGTCTCGCTTCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001135686
TARM1 MISSION shRNA shRNA Plasmid DNA
T cell-interacting, activating receptor on myeloid cells 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-203s21c1
Sequence:CCGGCTCAGGAAGGGAGGAATTATTCTCGAGAATAATTCCTCCCTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-375s21c1
Sequence:CCGGTGTTGGTGACAGGACATTTATCTCGAGATAAATGTCCTGTCACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-654s21c1
Sequence:CCGGCCAGTGATCAGCTTGAGATATCTCGAGATATCTCAAGCTGATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-263s21c1
Sequence:CCGGGCCGAATTTCACCTCAATAATCTCGAGATTATTGAGGTGAAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-460s21c1
Sequence:CCGGGTGCCAGAAGCGAGACCAATTCTCGAGAATTGGTCTCGCTTCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001135686
TARM1 MISSION shRNA Lentiviral Transduction Particles
T cell-interacting, activating receptor on myeloid cells 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-203s21c1
Sequence:CCGGCTCAGGAAGGGAGGAATTATTCTCGAGAATAATTCCTCCCTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-375s21c1
Sequence:CCGGTGTTGGTGACAGGACATTTATCTCGAGATAAATGTCCTGTCACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-654s21c1
Sequence:CCGGCCAGTGATCAGCTTGAGATATCTCGAGATATCTCAAGCTGATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-263s21c1
Sequence:CCGGGCCGAATTTCACCTCAATAATCTCGAGATTATTGAGGTGAAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135686.1-460s21c1
Sequence:CCGGGTGCCAGAAGCGAGACCAATTCTCGAGAATTGGTCTCGCTTCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks