EMAIL THIS PAGE TO A FRIEND

TARP

Synonyms: CD3G TCRG TCRGC1 TCRGC2
Gene ID:
Human(445347) Summary: In some non-lymphoid tissues, the unrearranged T cell receptor gamma (TRG@) locus is expressed. The resulting transcript contains a subset of the TRG@ gene segments and is shorter than TRG@ transcripts expressed in lymphoid tissues. This RefSeq record represents the unrearranged TRG@ locus transcript; the complete TRG@ locus is represented by the genomic RefSeq NG_001336. The transcript represented by this RefSeq has two open reading frames (ORFs) that encode different proteins. The downstream ORF is in the same frame as TRG@ and its protein product is similar to TRG@ proteins. The upstream ORF uses a different reading frame and encodes a novel protein. [provided by RefSeq, Jul 2008]
chicken(776306) TCR gamma alternate reading frame protein
dog(609288) TCR gamma alternate reading frame protein
domestic cat(100192304) TCR gamma alternate reading frame protein
cow(100335800) TCR gamma alternate reading frame protein
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107578 Anti-TARP antibody produced in rabbit affinity isolated antibody horse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003799 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003799 Rosetta Predictions human pricing
NM_001003806 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091295 predicted 382
2 SASI_Hs01_00091296 predicted 394
3 SASI_Hs01_00091297 predicted 676
4 SASI_Hs01_00091298 predicted 318
5 SASI_Hs01_00091299 predicted 683
6 SASI_Hs01_00091300 predicted 460
7 SASI_Hs01_00091301 predicted 632
8 SASI_Hs01_00091302 predicted 640
9 SASI_Hs01_00091303 predicted 252
10 SASI_Hs01_00091304 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015425 predicted 388
2 SASI_Hs01_00015426 predicted 350
3 SASI_Hs01_00015427 predicted 393
4 SASI_Hs01_00015428 predicted 673
5 SASI_Hs01_00015429 predicted 756
6 SASI_Hs01_00015430 predicted 686
7 SASI_Hs01_00015431 predicted 453
8 SASI_Hs01_00015432 predicted 552
9 SASI_Hs01_00015434 predicted 681
10 SASI_Hs02_00304396 predicted 635
11 SASI_Hs01_00015433 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003799
TARP MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-121s1c1
Sequence:CCGGGAAACAAAGCTCCAGAAGGCTCTCGAGAGCCTTCTGGAGCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-643s1c1
Sequence:CCGGCTGAGGATCTAGTTGGGCTTTCTCGAGAAAGCCCAACTAGATCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-118s1c1
Sequence:CCGGGCTGAAACAAAGCTCCAGAAGCTCGAGCTTCTGGAGCTTTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-146s1c1
Sequence:CCGGCATACCTTTGTCTTCTTGAGACTCGAGTCTCAAGAAGACAAAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-106s1c1
Sequence:CCGGCTTCCTTCAATTGCTGAAACACTCGAGTGTTTCAGCAATTGAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-316s1c1
Sequence:CCGGCACAGATGTATCGTCAGACATCTCGAGATGTCTGACGATACATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-139s1c1
Sequence:CCGGGCTGGAACATACCTTTGTCTTCTCGAGAAGACAAAGGTATGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-498s1c1
Sequence:CCGGCCTCAAGAGTGTGGTCTATTTCTCGAGAAATAGACCACACTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-615s1c1
Sequence:CCGGCATCGGTTATTGTCCCTAGAACTCGAGTTCTAGGGACAATAACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-612s1c1
Sequence:CCGGCCTCATCGGTTATTGTCCCTACTCGAGTAGGGACAATAACCGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003799
TARP MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-121s1c1
Sequence:CCGGGAAACAAAGCTCCAGAAGGCTCTCGAGAGCCTTCTGGAGCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-643s1c1
Sequence:CCGGCTGAGGATCTAGTTGGGCTTTCTCGAGAAAGCCCAACTAGATCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-118s1c1
Sequence:CCGGGCTGAAACAAAGCTCCAGAAGCTCGAGCTTCTGGAGCTTTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-146s1c1
Sequence:CCGGCATACCTTTGTCTTCTTGAGACTCGAGTCTCAAGAAGACAAAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-106s1c1
Sequence:CCGGCTTCCTTCAATTGCTGAAACACTCGAGTGTTTCAGCAATTGAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-316s1c1
Sequence:CCGGCACAGATGTATCGTCAGACATCTCGAGATGTCTGACGATACATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-139s1c1
Sequence:CCGGGCTGGAACATACCTTTGTCTTCTCGAGAAGACAAAGGTATGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-498s1c1
Sequence:CCGGCCTCAAGAGTGTGGTCTATTTCTCGAGAAATAGACCACACTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-615s1c1
Sequence:CCGGCATCGGTTATTGTCCCTAGAACTCGAGTTCTAGGGACAATAACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-612s1c1
Sequence:CCGGCCTCATCGGTTATTGTCCCTACTCGAGTAGGGACAATAACCGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003799
TARP MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-121s1c1
Sequence:CCGGGAAACAAAGCTCCAGAAGGCTCTCGAGAGCCTTCTGGAGCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-643s1c1
Sequence:CCGGCTGAGGATCTAGTTGGGCTTTCTCGAGAAAGCCCAACTAGATCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-118s1c1
Sequence:CCGGGCTGAAACAAAGCTCCAGAAGCTCGAGCTTCTGGAGCTTTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-146s1c1
Sequence:CCGGCATACCTTTGTCTTCTTGAGACTCGAGTCTCAAGAAGACAAAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-106s1c1
Sequence:CCGGCTTCCTTCAATTGCTGAAACACTCGAGTGTTTCAGCAATTGAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-316s1c1
Sequence:CCGGCACAGATGTATCGTCAGACATCTCGAGATGTCTGACGATACATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003799.1-139s1c1
Sequence:CCGGGCTGGAACATACCTTTGTCTTCTCGAGAAGACAAAGGTATGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-498s1c1
Sequence:CCGGCCTCAAGAGTGTGGTCTATTTCTCGAGAAATAGACCACACTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-615s1c1
Sequence:CCGGCATCGGTTATTGTCCCTAGAACTCGAGTTCTAGGGACAATAACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003799.1-612s1c1
Sequence:CCGGCCTCATCGGTTATTGTCCCTACTCGAGTAGGGACAATAACCGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks