EMAIL THIS PAGE TO A FRIEND

TARS2

threonyl-tRNA synthetase 2, mitochondrial (putative)

Synonyms: TARSL1 thrRS
UniProtKB ID: Q9BW92, Q53GW7, Q96I50
Gene ID:
Human(80222) Summary: This gene encodes a member of the class-II aminoacyl-tRNA synthetase family. The encoded protein is a mitochondrial aminoacyl-tRNA synthetase. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 4. [provided by RefSeq, Dec 2012]
Mouse(71807) threonyl-tRNA synthetase 2, mitochondrial (putative)
Rat(310672) threonyl-tRNA synthetase 2, mitochondrial (putative)
chicken(770407) threonyl-tRNA synthetase 2, mitochondrial (putative)
domestic cat(101085228) threonyl-tRNA synthetase 2, mitochondrial (putative)
dog(608006) threonyl-tRNA synthetase 2, mitochondrial (putative)
naked mole-rat(101722096) threonyl-tRNA synthetase 2, mitochondrial (putative)
Domestic Rabbit(100339248) threonyl-tRNA synthetase 2, mitochondrial (putative)
domestic guinea pig(100735793) threonyl-tRNA synthetase 2, mitochondrial (putative)
cow(511740) threonyl-tRNA synthetase 2, mitochondrial (putative)
sheep(101105117) threonyl-tRNA synthetase 2, mitochondrial (putative)
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027931 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027931 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027931 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025150 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025150 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025150 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078551 MISSION® esiRNA esiRNA human TARS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025150 Rosetta Predictions human pricing
NM_001014040 Rosetta Predictions rat pricing
NM_027931 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175056 predicted 2030
2 SASI_Hs01_00175057 predicted 1698
3 SASI_Hs01_00175058 predicted 1007
4 SASI_Hs01_00175059 predicted 249
5 SASI_Hs01_00175060 predicted 666
6 SASI_Hs01_00175061 predicted 552
7 SASI_Hs01_00175062 predicted 1414
8 SASI_Hs01_00175063 predicted 636
9 SASI_Hs01_00175064 predicted 1693
10 SASI_Hs01_00175065 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103760 predicted 200
2 SASI_Rn01_00103761 predicted 664
3 SASI_Rn02_00201429 predicted 877
4 SASI_Rn01_00103762 predicted 2028
5 SASI_Rn01_00103763 predicted 2023
6 SASI_Rn01_00103764 predicted 452
7 SASI_Rn01_00103765 predicted 707
8 SASI_Rn01_00103766 predicted 656
9 SASI_Rn01_00103767 predicted 572
10 SASI_Rn01_00103768 predicted 573
11 SASI_Rn01_00103769 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076321 predicted 1638
2 SASI_Mm01_00076322 predicted 376
3 SASI_Mm02_00332909 predicted 721
4 SASI_Mm01_00076323 predicted 201
5 SASI_Mm01_00076324 predicted 674
6 SASI_Mm01_00076325 predicted 467
7 SASI_Mm01_00076326 predicted 1142
8 SASI_Mm01_00076327 predicted 1472
9 SASI_Mm01_00076328 predicted 2076
10 SASI_Mm01_00076329 predicted 277
11 SASI_Mm01_00076330 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027931
VALIDATED
TARS2 MISSION shRNA Bacterial Glycerol Stock
threonyl-tRNA synthetase 2, mitochondrial (putative)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027931.3-1706s21c1
Sequence:CCGGGCCTTGGAGAAGTTTGGAGAACTCGAGTTCTCCAAACTTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027931.3-2312s21c1
Sequence:CCGGGTCATGTCCATTGGTGATGTACTCGAGTACATCACCAATGGACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027931.3-1592s21c1
Sequence:CCGGCGGTGTGTTTACTCGGTTCTTCTCGAGAAGAACCGAGTAAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027931.3-2197s21c1
Sequence:CCGGGAACGTACGCACGCGAGATAACTCGAGTTATCTCGCGTGCGTACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027931.1-2198s1c1
Sequence:CCGGGTCATGTCCATTGGTGATGTACTCGAGTACATCACCAATGGACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027931.1-2065s1c1
Sequence:CCGGGCAGAGTCAAAGGACAGTGAACTCGAGTTCACTGTCCTTTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027931.1-1592s1c1
Sequence:CCGGGCCTTGGAGAAGTTTGGAGAACTCGAGTTCTCCAAACTTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027931.1-1478s1c1
Sequence:CCGGCGGTGTGTTTACTCGGTTCTTCTCGAGAAGAACCGAGTAAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027931.1-2027s1c1
Sequence:CCGGGCCCACTACAACTTTCAGTTTCTCGAGAAACTGAAAGTTGTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027931
VALIDATED
TARS2 MISSION shRNA shRNA Plasmid DNA
threonyl-tRNA synthetase 2, mitochondrial (putative)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027931.3-1706s21c1
Sequence:CCGGGCCTTGGAGAAGTTTGGAGAACTCGAGTTCTCCAAACTTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027931.3-2312s21c1
Sequence:CCGGGTCATGTCCATTGGTGATGTACTCGAGTACATCACCAATGGACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027931.3-1592s21c1
Sequence:CCGGCGGTGTGTTTACTCGGTTCTTCTCGAGAAGAACCGAGTAAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027931.3-2197s21c1
Sequence:CCGGGAACGTACGCACGCGAGATAACTCGAGTTATCTCGCGTGCGTACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027931.1-2198s1c1
Sequence:CCGGGTCATGTCCATTGGTGATGTACTCGAGTACATCACCAATGGACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027931.1-2065s1c1
Sequence:CCGGGCAGAGTCAAAGGACAGTGAACTCGAGTTCACTGTCCTTTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027931.1-1592s1c1
Sequence:CCGGGCCTTGGAGAAGTTTGGAGAACTCGAGTTCTCCAAACTTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027931.1-1478s1c1
Sequence:CCGGCGGTGTGTTTACTCGGTTCTTCTCGAGAAGAACCGAGTAAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027931.1-2027s1c1
Sequence:CCGGGCCCACTACAACTTTCAGTTTCTCGAGAAACTGAAAGTTGTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027931
VALIDATED
TARS2 MISSION shRNA Lentiviral Transduction Particles
threonyl-tRNA synthetase 2, mitochondrial (putative)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027931.3-1706s21c1
Sequence:CCGGGCCTTGGAGAAGTTTGGAGAACTCGAGTTCTCCAAACTTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027931.3-2312s21c1
Sequence:CCGGGTCATGTCCATTGGTGATGTACTCGAGTACATCACCAATGGACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027931.3-1592s21c1
Sequence:CCGGCGGTGTGTTTACTCGGTTCTTCTCGAGAAGAACCGAGTAAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027931.3-2197s21c1
Sequence:CCGGGAACGTACGCACGCGAGATAACTCGAGTTATCTCGCGTGCGTACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027931.1-2198s1c1
Sequence:CCGGGTCATGTCCATTGGTGATGTACTCGAGTACATCACCAATGGACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027931.1-2065s1c1
Sequence:CCGGGCAGAGTCAAAGGACAGTGAACTCGAGTTCACTGTCCTTTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027931.1-1592s1c1
Sequence:CCGGGCCTTGGAGAAGTTTGGAGAACTCGAGTTCTCCAAACTTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027931.1-1478s1c1
Sequence:CCGGCGGTGTGTTTACTCGGTTCTTCTCGAGAAGAACCGAGTAAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027931.1-2027s1c1
Sequence:CCGGGCCCACTACAACTTTCAGTTTCTCGAGAAACTGAAAGTTGTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025150
VALIDATED
TARS2 MISSION shRNA Bacterial Glycerol Stock
threonyl-tRNA synthetase 2, mitochondrial (putative)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025150.3-1699s21c1
Sequence:CCGGCCTGAGATTTGACCTCCAGTACTCGAGTACTGGAGGTCAAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025150.3-470s21c1
Sequence:CCGGCCAAGTACAGAATATGGCTTTCTCGAGAAAGCCATATTCTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025150.3-2168s21c1
Sequence:CCGGTTTGTACATAGATGAGGCAAACTCGAGTTTGCCTCATCTATGTACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025150.3-1535s21c1
Sequence:CCGGCAGGCCGAACAGGTCCTTAAACTCGAGTTTAAGGACCTGTTCGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025150.3-2137s21c1
Sequence:CCGGGGTCCCAAATGCCGAAGAAATCTCGAGATTTCTTCGGCATTTGGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025150.3-182s1c1
Sequence:CCGGCGGACTATTAAGATATCACTTCTCGAGAAGTGATATCTTAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025150.3-1016s1c1
Sequence:CCGGGCGTTTATCAGGGCTGAGTATCTCGAGATACTCAGCCCTGATAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025150.3-1428s1c1
Sequence:CCGGGCTGTCTTGATTTCCTCCGTTCTCGAGAACGGAGGAAATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025150.3-470s1c1
Sequence:CCGGCCAAGTACAGAATATGGCTTTCTCGAGAAAGCCATATTCTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025150.3-1699s1c1
Sequence:CCGGCCTGAGATTTGACCTCCAGTACTCGAGTACTGGAGGTCAAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025150
VALIDATED
TARS2 MISSION shRNA shRNA Plasmid DNA
threonyl-tRNA synthetase 2, mitochondrial (putative)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025150.3-1699s21c1
Sequence:CCGGCCTGAGATTTGACCTCCAGTACTCGAGTACTGGAGGTCAAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025150.3-470s21c1
Sequence:CCGGCCAAGTACAGAATATGGCTTTCTCGAGAAAGCCATATTCTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025150.3-2168s21c1
Sequence:CCGGTTTGTACATAGATGAGGCAAACTCGAGTTTGCCTCATCTATGTACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025150.3-1535s21c1
Sequence:CCGGCAGGCCGAACAGGTCCTTAAACTCGAGTTTAAGGACCTGTTCGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025150.3-2137s21c1
Sequence:CCGGGGTCCCAAATGCCGAAGAAATCTCGAGATTTCTTCGGCATTTGGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025150.3-182s1c1
Sequence:CCGGCGGACTATTAAGATATCACTTCTCGAGAAGTGATATCTTAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025150.3-1016s1c1
Sequence:CCGGGCGTTTATCAGGGCTGAGTATCTCGAGATACTCAGCCCTGATAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025150.3-1428s1c1
Sequence:CCGGGCTGTCTTGATTTCCTCCGTTCTCGAGAACGGAGGAAATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025150.3-470s1c1
Sequence:CCGGCCAAGTACAGAATATGGCTTTCTCGAGAAAGCCATATTCTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025150.3-1699s1c1
Sequence:CCGGCCTGAGATTTGACCTCCAGTACTCGAGTACTGGAGGTCAAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025150
VALIDATED
TARS2 MISSION shRNA Lentiviral Transduction Particles
threonyl-tRNA synthetase 2, mitochondrial (putative)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025150.3-1699s21c1
Sequence:CCGGCCTGAGATTTGACCTCCAGTACTCGAGTACTGGAGGTCAAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025150.3-470s21c1
Sequence:CCGGCCAAGTACAGAATATGGCTTTCTCGAGAAAGCCATATTCTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025150.3-2168s21c1
Sequence:CCGGTTTGTACATAGATGAGGCAAACTCGAGTTTGCCTCATCTATGTACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025150.3-1535s21c1
Sequence:CCGGCAGGCCGAACAGGTCCTTAAACTCGAGTTTAAGGACCTGTTCGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025150.3-2137s21c1
Sequence:CCGGGGTCCCAAATGCCGAAGAAATCTCGAGATTTCTTCGGCATTTGGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025150.3-182s1c1
Sequence:CCGGCGGACTATTAAGATATCACTTCTCGAGAAGTGATATCTTAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025150.3-1016s1c1
Sequence:CCGGGCGTTTATCAGGGCTGAGTATCTCGAGATACTCAGCCCTGATAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025150.3-1428s1c1
Sequence:CCGGGCTGTCTTGATTTCCTCCGTTCTCGAGAACGGAGGAAATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025150.3-470s1c1
Sequence:CCGGCCAAGTACAGAATATGGCTTTCTCGAGAAAGCCATATTCTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025150.3-1699s1c1
Sequence:CCGGCCTGAGATTTGACCTCCAGTACTCGAGTACTGGAGGTCAAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks