EMAIL THIS PAGE TO A FRIEND

TARS

threonyl-tRNA synthetase

Synonyms: ThrRS
UniProtKB ID: P26639, A8K8I1, B4DEG8, Q96FP5, Q9BWA6
Gene ID:
Human(6897) Summary: Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Threonyl-tRNA synthetase belongs to the class-II aminoacyl-tRNA synthetase family [provided by RefSeq, Jul 2008]
Mouse(110960) threonyl-tRNA synthetase
Rat(294810) threonyl-tRNA synthetase
cow(510075) threonyl-tRNA synthetase
sheep(101114306) threonyl-tRNA synthetase
domestic guinea pig(100724017) threonyl-tRNA synthetase
naked mole-rat(101721474) threonyl-tRNA synthetase
Zebrafish(449661) threonyl-tRNA synthetase
chicken(427427) threonyl-tRNA synthetase
dog(479370) threonyl-tRNA synthetase
Horse(100068323) threonyl-tRNA synthetase
domestic cat(101082377) threonyl-tRNA synthetase
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV46359 Anti-TARS antibody produced in rabbit IgG fraction of antiserum , rat, guinea pig, rabbit, zebrafish, bovine, horse, human, canine, mouse
immunohistochemistry, western blot pricing
HPA037425 Anti-TARS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2702096 Anti-TARS antibody produced in rabbit mouse, human
immunohistochemistry, western blot pricing
WH0006897M1 Monoclonal Anti-TARS antibody produced in mouse clone 1A9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152295 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152295 Rosetta Predictions human pricing
NM_001006976 Rosetta Predictions rat pricing
NM_033074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114626 predicted 1343
2 SASI_Hs01_00114627 predicted 702
3 SASI_Hs01_00114628 predicted 769
4 SASI_Hs01_00114629 predicted 1232
5 SASI_Hs01_00114630 predicted 1995
6 SASI_Hs01_00114631 predicted 1362
7 SASI_Hs01_00114632 predicted 1352
8 SASI_Hs01_00114633 predicted 1043
9 SASI_Hs01_00114634 predicted 1017
10 SASI_Hs01_00114635 predicted 2089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198541 predicted 438
2 SASI_Rn01_00108637 predicted 1010
3 SASI_Rn01_00108638 predicted 1666
4 SASI_Rn01_00108639 predicted 1478
5 SASI_Rn01_00108641 predicted 271
6 SASI_Rn02_00198542 predicted 566
7 SASI_Rn01_00108642 predicted 1952
8 SASI_Rn01_00108643 predicted 1027
9 SASI_Rn01_00108644 predicted 656
10 SASI_Rn01_00108645 predicted 686
11 SASI_Rn01_00108636 predicted 568
12 SASI_Rn01_00108640 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195574 predicted 302
2 SASI_Mm02_00337278 predicted 589
3 SASI_Mm01_00195575 predicted 754
4 SASI_Mm01_00195576 predicted 1161
5 SASI_Mm01_00195577 predicted 2107
6 SASI_Mm01_00195578 predicted 1320
7 SASI_Mm01_00195579 predicted 1178
8 SASI_Mm01_00195580 predicted 2030
9 SASI_Mm01_00195582 predicted 1673
10 SASI_Mm02_00337279 predicted 1823
11 SASI_Mm01_00195581 predicted 848
12 SASI_Mm01_00195583 predicted 2004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152295
VALIDATED
TARS MISSION shRNA Bacterial Glycerol Stock
threonyl-tRNA synthetase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152295.3-2346s1c1
Sequence:CCGGGCACTGTTAATATCCGCACAACTCGAGTTGTGCGGATATTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152295.3-2181s1c1
Sequence:CCGGCCTGTGATGAATATGCCCAAACTCGAGTTTGGGCATATTCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152295.3-1175s1c1
Sequence:CCGGCTCCAGAGAATTTATGGCATTCTCGAGAATGCCATAAATTCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152295.3-757s1c1
Sequence:CCGGGCACTCTAGTGCTCACATAATCTCGAGATTATGTGAGCACTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_152295.3-1343s1c1
Sequence:CCGGGCCTACATTTATAATGCACTTCTCGAGAAGTGCATTATAAATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-1745s21c1
Sequence:CCGGCGTACGGTATATAGCGTATTTCTCGAGAAATACGCTATATACCGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-633s21c1
Sequence:CCGGTGGCCGACAACACCGTTATTGCTCGAGCAATAACGGTGTTGTCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-2346s21c1
Sequence:CCGGGCACTGTTAATATCCGCACAACTCGAGTTGTGCGGATATTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-757s21c1
Sequence:CCGGGCACTCTAGTGCTCACATAATCTCGAGATTATGTGAGCACTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-2592s21c1
Sequence:CCGGCAACCTGCAGGCGTAACTATTCTCGAGAATAGTTACGCCTGCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152295
VALIDATED
TARS MISSION shRNA shRNA Plasmid DNA
threonyl-tRNA synthetase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152295.3-2346s1c1
Sequence:CCGGGCACTGTTAATATCCGCACAACTCGAGTTGTGCGGATATTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152295.3-2181s1c1
Sequence:CCGGCCTGTGATGAATATGCCCAAACTCGAGTTTGGGCATATTCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152295.3-1175s1c1
Sequence:CCGGCTCCAGAGAATTTATGGCATTCTCGAGAATGCCATAAATTCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152295.3-757s1c1
Sequence:CCGGGCACTCTAGTGCTCACATAATCTCGAGATTATGTGAGCACTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_152295.3-1343s1c1
Sequence:CCGGGCCTACATTTATAATGCACTTCTCGAGAAGTGCATTATAAATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-1745s21c1
Sequence:CCGGCGTACGGTATATAGCGTATTTCTCGAGAAATACGCTATATACCGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-633s21c1
Sequence:CCGGTGGCCGACAACACCGTTATTGCTCGAGCAATAACGGTGTTGTCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-2346s21c1
Sequence:CCGGGCACTGTTAATATCCGCACAACTCGAGTTGTGCGGATATTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-757s21c1
Sequence:CCGGGCACTCTAGTGCTCACATAATCTCGAGATTATGTGAGCACTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-2592s21c1
Sequence:CCGGCAACCTGCAGGCGTAACTATTCTCGAGAATAGTTACGCCTGCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152295
VALIDATED
TARS MISSION shRNA Lentiviral Transduction Particles
threonyl-tRNA synthetase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152295.3-2346s1c1
Sequence:CCGGGCACTGTTAATATCCGCACAACTCGAGTTGTGCGGATATTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152295.3-2181s1c1
Sequence:CCGGCCTGTGATGAATATGCCCAAACTCGAGTTTGGGCATATTCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152295.3-1175s1c1
Sequence:CCGGCTCCAGAGAATTTATGGCATTCTCGAGAATGCCATAAATTCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152295.3-757s1c1
Sequence:CCGGGCACTCTAGTGCTCACATAATCTCGAGATTATGTGAGCACTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_152295.3-1343s1c1
Sequence:CCGGGCCTACATTTATAATGCACTTCTCGAGAAGTGCATTATAAATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-1745s21c1
Sequence:CCGGCGTACGGTATATAGCGTATTTCTCGAGAAATACGCTATATACCGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-633s21c1
Sequence:CCGGTGGCCGACAACACCGTTATTGCTCGAGCAATAACGGTGTTGTCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-2346s21c1
Sequence:CCGGGCACTGTTAATATCCGCACAACTCGAGTTGTGCGGATATTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-757s21c1
Sequence:CCGGGCACTCTAGTGCTCACATAATCTCGAGATTATGTGAGCACTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152295.3-2592s21c1
Sequence:CCGGCAACCTGCAGGCGTAACTATTCTCGAGAATAGTTACGCCTGCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033074
VALIDATED
TARS MISSION shRNA Bacterial Glycerol Stock
threonyl-tRNA synthetase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-2415s1c1
Sequence:CCGGCAAGTCTTAGAGAATGTTGTACTCGAGTACAACATTCTCTAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-660s1c1
Sequence:CCGGCGGCTTCTATTATGATATGTACTCGAGTACATATCATAATAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-2122s1c1
Sequence:CCGGCAGTATAACTTCATCCTTGTTCTCGAGAACAAGGATGAAGTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-1002s1c1
Sequence:CCGGGCGGATCTATGGCATTTCATTCTCGAGAATGAAATGCCATAGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033074.3-1001s21c1
Sequence:CCGGGCGGATCTATGGCATTTCATTCTCGAGAATGAAATGCCATAGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-2119s1c2
Sequence:CCGGGCACAGTATAACTTCATCCTTCTCGAGAAGGATGAAGTTATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033074.3-659s21c1
Sequence:CCGGCGGCTTCTATTATGATATGTACTCGAGTACATATCATAATAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033074.3-2414s21c1
Sequence:CCGGCAAGTCTTAGAGAATGTTGTACTCGAGTACAACATTCTCTAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033074.3-2121s21c1
Sequence:CCGGCAGTATAACTTCATCCTTGTTCTCGAGAACAAGGATGAAGTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033074
VALIDATED
TARS MISSION shRNA shRNA Plasmid DNA
threonyl-tRNA synthetase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-2415s1c1
Sequence:CCGGCAAGTCTTAGAGAATGTTGTACTCGAGTACAACATTCTCTAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-660s1c1
Sequence:CCGGCGGCTTCTATTATGATATGTACTCGAGTACATATCATAATAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-2122s1c1
Sequence:CCGGCAGTATAACTTCATCCTTGTTCTCGAGAACAAGGATGAAGTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-1002s1c1
Sequence:CCGGGCGGATCTATGGCATTTCATTCTCGAGAATGAAATGCCATAGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033074.3-1001s21c1
Sequence:CCGGGCGGATCTATGGCATTTCATTCTCGAGAATGAAATGCCATAGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-2119s1c2
Sequence:CCGGGCACAGTATAACTTCATCCTTCTCGAGAAGGATGAAGTTATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033074.3-659s21c1
Sequence:CCGGCGGCTTCTATTATGATATGTACTCGAGTACATATCATAATAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033074.3-2414s21c1
Sequence:CCGGCAAGTCTTAGAGAATGTTGTACTCGAGTACAACATTCTCTAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033074.3-2121s21c1
Sequence:CCGGCAGTATAACTTCATCCTTGTTCTCGAGAACAAGGATGAAGTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033074
VALIDATED
TARS MISSION shRNA Lentiviral Transduction Particles
threonyl-tRNA synthetase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-2415s1c1
Sequence:CCGGCAAGTCTTAGAGAATGTTGTACTCGAGTACAACATTCTCTAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-660s1c1
Sequence:CCGGCGGCTTCTATTATGATATGTACTCGAGTACATATCATAATAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-2122s1c1
Sequence:CCGGCAGTATAACTTCATCCTTGTTCTCGAGAACAAGGATGAAGTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-1002s1c1
Sequence:CCGGGCGGATCTATGGCATTTCATTCTCGAGAATGAAATGCCATAGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033074.3-1001s21c1
Sequence:CCGGGCGGATCTATGGCATTTCATTCTCGAGAATGAAATGCCATAGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033074.2-2119s1c2
Sequence:CCGGGCACAGTATAACTTCATCCTTCTCGAGAAGGATGAAGTTATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033074.3-659s21c1
Sequence:CCGGCGGCTTCTATTATGATATGTACTCGAGTACATATCATAATAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033074.3-2414s21c1
Sequence:CCGGCAAGTCTTAGAGAATGTTGTACTCGAGTACAACATTCTCTAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033074.3-2121s21c1
Sequence:CCGGCAGTATAACTTCATCCTTGTTCTCGAGAACAAGGATGAAGTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks