EMAIL THIS PAGE TO A FRIEND

TARSL2

threonyl-tRNA synthetase-like 2

UniProtKB ID: A2RTX5, B2RMP7, Q6B0A1, Q6IS76, Q96LW3, Q96MP4
Gene ID:
Mouse(272396) threonyl-tRNA synthetase-like 2
Rat(308701) threonyl-tRNA synthetase-like 2
chicken(415389) threonyl-tRNA synthetase-like 2
dog(479019) threonyl-tRNA synthetase-like 2
domestic cat(101084454) threonyl-tRNA synthetase-like 2
cow(525350) threonyl-tRNA synthetase-like 2
sheep(101111581) threonyl-tRNA synthetase-like 2
domestic guinea pig(100717860) threonyl-tRNA synthetase-like 2
Domestic Rabbit(100346648) threonyl-tRNA synthetase-like 2
naked mole-rat(101697257) threonyl-tRNA synthetase-like 2
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152334 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089901 MISSION® esiRNA esiRNA human TARSL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152334 Rosetta Predictions human pricing
NM_001014020 Rosetta Predictions rat pricing
NM_172310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185732 predicted 521
2 SASI_Hs01_00185733 predicted 2390
3 SASI_Hs01_00185734 predicted 1176
4 SASI_Hs01_00185736 predicted 700
5 SASI_Hs01_00185737 predicted 893
6 SASI_Hs01_00185738 predicted 1987
7 SASI_Hs01_00185740 predicted 1341
8 SASI_Hs01_00185741 predicted 2224
9 SASI_Hs02_00365933 predicted 2525
10 SASI_Hs02_00365934 predicted 1517
11 SASI_Hs01_00185735 predicted 1481
12 SASI_Hs01_00185739 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121204 predicted 988
2 SASI_Rn01_00121205 predicted 457
3 SASI_Rn01_00121206 predicted 1509
4 SASI_Rn01_00121207 predicted 1632
5 SASI_Rn01_00121208 predicted 1332
6 SASI_Rn01_00121210 predicted 1115
7 SASI_Rn01_00121211 predicted 1278
8 SASI_Rn01_00121212 predicted 1510
9 SASI_Rn01_00121213 predicted 764
10 SASI_Rn02_00201402 predicted 1510
11 SASI_Rn01_00121209 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082760 predicted 745
2 SASI_Mm01_00082761 predicted 1507
3 SASI_Mm01_00082762 predicted 1933
4 SASI_Mm02_00343816 predicted 2326
5 SASI_Mm01_00082763 predicted 1518
6 SASI_Mm01_00082764 predicted 2124
7 SASI_Mm01_00082765 predicted 578
8 SASI_Mm01_00082766 predicted 1688
9 SASI_Mm01_00082767 predicted 998
10 SASI_Mm01_00082768 predicted 2463
11 SASI_Mm01_00082769 predicted 2299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152334
TARSL2 MISSION shRNA Bacterial Glycerol Stock
threonyl-tRNA synthetase-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152334.2-1953s1c1
Sequence:CCGGGATACCATCAATGTGCTACAACTCGAGTTGTAGCACATTGATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152334.2-1849s1c1
Sequence:CCGGGCAGAACAGCTTGATGGACTTCTCGAGAAGTCCATCAAGCTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152334.2-2353s1c1
Sequence:CCGGCGTGCGAACAAGAGACAACAACTCGAGTTGTTGTCTCTTGTTCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152334.2-1955s21c1
Sequence:CCGGTACCATCAATGTGCTACAATTCTCGAGAATTGTAGCACATTGATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152334.2-1570s21c1
Sequence:CCGGTTGGAGGGAAATGCCTATTAGCTCGAGCTAATAGGCATTTCCCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152334.2-2610s21c1
Sequence:CCGGAGCTGACATGCACGAAGTTTACTCGAGTAAACTTCGTGCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152334.2-1981s21c1
Sequence:CCGGGGACTTCCAACTGCCTATTAGCTCGAGCTAATAGGCAGTTGGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152334
TARSL2 MISSION shRNA shRNA Plasmid DNA
threonyl-tRNA synthetase-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152334.2-1953s1c1
Sequence:CCGGGATACCATCAATGTGCTACAACTCGAGTTGTAGCACATTGATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152334.2-1849s1c1
Sequence:CCGGGCAGAACAGCTTGATGGACTTCTCGAGAAGTCCATCAAGCTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152334.2-2353s1c1
Sequence:CCGGCGTGCGAACAAGAGACAACAACTCGAGTTGTTGTCTCTTGTTCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152334.2-1955s21c1
Sequence:CCGGTACCATCAATGTGCTACAATTCTCGAGAATTGTAGCACATTGATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152334.2-1570s21c1
Sequence:CCGGTTGGAGGGAAATGCCTATTAGCTCGAGCTAATAGGCATTTCCCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152334.2-2610s21c1
Sequence:CCGGAGCTGACATGCACGAAGTTTACTCGAGTAAACTTCGTGCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152334.2-1981s21c1
Sequence:CCGGGGACTTCCAACTGCCTATTAGCTCGAGCTAATAGGCAGTTGGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152334
TARSL2 MISSION shRNA Lentiviral Transduction Particles
threonyl-tRNA synthetase-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152334.2-1953s1c1
Sequence:CCGGGATACCATCAATGTGCTACAACTCGAGTTGTAGCACATTGATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152334.2-1849s1c1
Sequence:CCGGGCAGAACAGCTTGATGGACTTCTCGAGAAGTCCATCAAGCTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152334.2-2353s1c1
Sequence:CCGGCGTGCGAACAAGAGACAACAACTCGAGTTGTTGTCTCTTGTTCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152334.2-1955s21c1
Sequence:CCGGTACCATCAATGTGCTACAATTCTCGAGAATTGTAGCACATTGATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152334.2-1570s21c1
Sequence:CCGGTTGGAGGGAAATGCCTATTAGCTCGAGCTAATAGGCATTTCCCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152334.2-2610s21c1
Sequence:CCGGAGCTGACATGCACGAAGTTTACTCGAGTAAACTTCGTGCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152334.2-1981s21c1
Sequence:CCGGGGACTTCCAACTGCCTATTAGCTCGAGCTAATAGGCAGTTGGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172310
TARSL2 MISSION shRNA Bacterial Glycerol Stock
threonyl-tRNA synthetase-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172310.1-998s1c1
Sequence:CCGGCCATTGATTGACCTTTGTAAACTCGAGTTTACAAAGGTCAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172310.1-2678s1c1
Sequence:CCGGGCGAGAATTATCAGAAATCATCTCGAGATGATTTCTGATAATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172310.1-550s1c1
Sequence:CCGGCGCTGGAATTAGTAAGGAATTCTCGAGAATTCCTTACTAATTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172310.1-1522s1c1
Sequence:CCGGGCCTGTTAGATTTGCTGATTTCTCGAGAAATCAGCAAATCTAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172310.1-1399s1c1
Sequence:CCGGGCAGCATTACAGTAACAACATCTCGAGATGTTGTTACTGTAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172310
TARSL2 MISSION shRNA shRNA Plasmid DNA
threonyl-tRNA synthetase-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172310.1-998s1c1
Sequence:CCGGCCATTGATTGACCTTTGTAAACTCGAGTTTACAAAGGTCAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172310.1-2678s1c1
Sequence:CCGGGCGAGAATTATCAGAAATCATCTCGAGATGATTTCTGATAATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172310.1-550s1c1
Sequence:CCGGCGCTGGAATTAGTAAGGAATTCTCGAGAATTCCTTACTAATTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172310.1-1522s1c1
Sequence:CCGGGCCTGTTAGATTTGCTGATTTCTCGAGAAATCAGCAAATCTAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172310.1-1399s1c1
Sequence:CCGGGCAGCATTACAGTAACAACATCTCGAGATGTTGTTACTGTAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172310
TARSL2 MISSION shRNA Lentiviral Transduction Particles
threonyl-tRNA synthetase-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172310.1-998s1c1
Sequence:CCGGCCATTGATTGACCTTTGTAAACTCGAGTTTACAAAGGTCAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172310.1-2678s1c1
Sequence:CCGGGCGAGAATTATCAGAAATCATCTCGAGATGATTTCTGATAATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172310.1-550s1c1
Sequence:CCGGCGCTGGAATTAGTAAGGAATTCTCGAGAATTCCTTACTAATTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172310.1-1522s1c1
Sequence:CCGGGCCTGTTAGATTTGCTGATTTCTCGAGAAATCAGCAAATCTAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172310.1-1399s1c1
Sequence:CCGGGCAGCATTACAGTAACAACATCTCGAGATGTTGTTACTGTAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks