EMAIL THIS PAGE TO A FRIEND

TAS1R1

taste receptor, type 1, member 1

Synonyms: GPR70 T1R1 TR1
Gene ID:
Human(80835) Summary: The protein encoded by this gene is a G protein-coupled receptor and is a component of the heterodimeric amino acid taste receptor T1R1+3. The T1R1+3 receptor responds to L-amino acids but not to D-enantiomers or other compounds. Most amino acids that are perceived as sweet activate T1R1+3, and this activation is strictly dependent on an intact T1R1+3 heterodimer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(110326) taste receptor, type 1, member 1
Rat(29407) taste receptor, type 1, member 1
Zebrafish(654781) taste receptor, type 1, member 1
dog(489633) taste receptor, type 1, member 1
Horse(100052182) taste receptor, type 1, member 1
chicken(428176) taste receptor, type 1, member 1
Domestic Rabbit(100353695) taste receptor, type 1, member 1
cow(523473) taste receptor, type 1, member 1
155 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138697 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138697 Rosetta Predictions human pricing
NM_177539 Rosetta Predictions human pricing
NM_177540 Rosetta Predictions human pricing
NM_177541 Rosetta Predictions human pricing
NM_053305 Rosetta Predictions rat pricing
NM_031867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161879 predicted 2415
2 SASI_Hs01_00161881 predicted 1981
3 SASI_Hs01_00161882 predicted 2162
4 SASI_Hs01_00161883 predicted 2335
5 SASI_Hs01_00161884 predicted 2067
6 SASI_Hs01_00161885 predicted 2227
7 SASI_Hs01_00161886 predicted 1947
8 SASI_Hs01_00161887 predicted 1946
9 SASI_Hs01_00161888 predicted 2138
10 SASI_Hs02_00363793 predicted 2269
11 SASI_Hs01_00161880 predicted 1962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204041 predicted 1905
2 SASI_Hs01_00204042 predicted 1618
3 SASI_Hs01_00204043 predicted 1649
4 SASI_Hs01_00204044 predicted 1824
5 SASI_Hs01_00204047 predicted 1893
6 SASI_Hs01_00204048 predicted 1609
7 SASI_Hs01_00204049 predicted 313
8 SASI_Hs01_00204050 predicted 1609
9 SASI_Hs02_00369389 predicted 1803
10 SASI_Hs02_00369390 predicted 477
11 SASI_Hs01_00204045 predicted 937
12 SASI_Hs01_00204046 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127847 predicted 1654
2 SASI_Hs01_00127848 predicted 1221
3 SASI_Hs01_00127849 predicted 1572
4 SASI_Hs01_00127850 predicted 704
5 SASI_Hs01_00127851 predicted 1299
6 SASI_Hs01_00127852 predicted 1467
7 SASI_Hs01_00127853 predicted 1182
8 SASI_Hs01_00127854 predicted 1176
9 SASI_Hs01_00127855 predicted 1374
10 SASI_Hs01_00127856 predicted 1506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101693 predicted 533
2 SASI_Hs01_00101694 predicted 647
3 SASI_Hs01_00101695 predicted 1018
4 SASI_Hs01_00101696 predicted 544
5 SASI_Hs02_00369391 predicted 646
6 SASI_Hs01_00101697 predicted 932
7 SASI_Hs01_00101698 predicted 708
8 SASI_Hs02_00369392 predicted 506
9 SASI_Hs01_00101699 predicted 637
10 SASI_Hs01_00101700 predicted 312
11 SASI_Hs01_00101701 predicted 569
12 SASI_Hs01_00101702 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265706 predicted 2027
2 SASI_Rn02_00265707 predicted 1977
3 SASI_Rn02_00265708 predicted 1151
4 SASI_Rn02_00265709 predicted 1370
5 SASI_Rn02_00265710 predicted 875
6 SASI_Rn02_00265711 predicted 1000
7 SASI_Rn02_00265712 predicted 1567
8 SASI_Rn02_00265713 predicted 310
9 SASI_Rn02_00265714 predicted 2332
10 SASI_Rn02_00265715 predicted 2264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129228 predicted 603
2 SASI_Mm02_00337180 predicted 1458
3 SASI_Mm01_00129230 predicted 750
4 SASI_Mm01_00129231 predicted 1554
5 SASI_Mm02_00337181 predicted 384
6 SASI_Mm01_00129232 predicted 2035
7 SASI_Mm01_00129233 predicted 2167
8 SASI_Mm01_00129234 predicted 2603
9 SASI_Mm01_00129235 predicted 2519
10 SASI_Mm01_00129236 predicted 359
11 SASI_Mm01_00129229 predicted 1403
12 SASI_Mm01_00129237 predicted 2328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138697
TAS1R1 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 1, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138697.2-1951s21c1
Sequence:CCGGGTTCGCTCATTCCAACTAATCCTCGAGGATTAGTTGGAATGAGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138697.2-1299s21c1
Sequence:CCGGCAAGGACACTGTGGCGTTTAACTCGAGTTAAACGCCACAGTGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138697.2-641s21c1
Sequence:CCGGTTGGCAGCAGTGACGACTATGCTCGAGCATAGTCGTCACTGCTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138697.2-2547s1c1
Sequence:CCGGGCTGGCAGCCTTCTCTGCCCTCTCGAGAGGGCAGAGAAGGCTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138697.2-2066s1c1
Sequence:CCGGCCCAGCTGCTTATCTGTCTAACTCGAGTTAGACAGATAAGCAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138697.2-714s1c1
Sequence:CCGGCATTGCTTTCAAGGACATCATCTCGAGATGATGTCCTTGAAAGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138697.2-1581s1c1
Sequence:CCGGCCTCAACAAGAGTGACCTCTACTCGAGTAGAGGTCACTCTTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138697.2-1312s1c1
Sequence:CCGGGCGTTTAATGACAACAGAGATCTCGAGATCTCTGTTGTCATTAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138697
TAS1R1 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 1, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138697.2-1951s21c1
Sequence:CCGGGTTCGCTCATTCCAACTAATCCTCGAGGATTAGTTGGAATGAGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138697.2-1299s21c1
Sequence:CCGGCAAGGACACTGTGGCGTTTAACTCGAGTTAAACGCCACAGTGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138697.2-641s21c1
Sequence:CCGGTTGGCAGCAGTGACGACTATGCTCGAGCATAGTCGTCACTGCTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138697.2-2547s1c1
Sequence:CCGGGCTGGCAGCCTTCTCTGCCCTCTCGAGAGGGCAGAGAAGGCTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138697.2-2066s1c1
Sequence:CCGGCCCAGCTGCTTATCTGTCTAACTCGAGTTAGACAGATAAGCAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138697.2-714s1c1
Sequence:CCGGCATTGCTTTCAAGGACATCATCTCGAGATGATGTCCTTGAAAGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138697.2-1581s1c1
Sequence:CCGGCCTCAACAAGAGTGACCTCTACTCGAGTAGAGGTCACTCTTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138697.2-1312s1c1
Sequence:CCGGGCGTTTAATGACAACAGAGATCTCGAGATCTCTGTTGTCATTAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138697
TAS1R1 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 1, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138697.2-1951s21c1
Sequence:CCGGGTTCGCTCATTCCAACTAATCCTCGAGGATTAGTTGGAATGAGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138697.2-1299s21c1
Sequence:CCGGCAAGGACACTGTGGCGTTTAACTCGAGTTAAACGCCACAGTGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138697.2-641s21c1
Sequence:CCGGTTGGCAGCAGTGACGACTATGCTCGAGCATAGTCGTCACTGCTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138697.2-2547s1c1
Sequence:CCGGGCTGGCAGCCTTCTCTGCCCTCTCGAGAGGGCAGAGAAGGCTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138697.2-2066s1c1
Sequence:CCGGCCCAGCTGCTTATCTGTCTAACTCGAGTTAGACAGATAAGCAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138697.2-714s1c1
Sequence:CCGGCATTGCTTTCAAGGACATCATCTCGAGATGATGTCCTTGAAAGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138697.2-1581s1c1
Sequence:CCGGCCTCAACAAGAGTGACCTCTACTCGAGTAGAGGTCACTCTTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138697.2-1312s1c1
Sequence:CCGGGCGTTTAATGACAACAGAGATCTCGAGATCTCTGTTGTCATTAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031867
TAS1R1 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 1, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-2609s1c1
Sequence:CCGGCCTCCCTAAATGCTACGTGATCTCGAGATCACGTAGCATTTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-2599s1c1
Sequence:CCGGGCGGCTATTTCCTCCCTAAATCTCGAGATTTAGGGAGGAAATAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-1289s1c1
Sequence:CCGGCGCTTTCACGACATGGAACATCTCGAGATGTTCCATGTCGTGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-2443s1c1
Sequence:CCGGCGGAGAACTATAACGAAGCCACTCGAGTGGCTTCGTTATAGTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-1517s1c1
Sequence:CCGGCCCTCTAGGTTATTATGACATCTCGAGATGTCATAATAACCTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031867
TAS1R1 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 1, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-2609s1c1
Sequence:CCGGCCTCCCTAAATGCTACGTGATCTCGAGATCACGTAGCATTTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-2599s1c1
Sequence:CCGGGCGGCTATTTCCTCCCTAAATCTCGAGATTTAGGGAGGAAATAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-1289s1c1
Sequence:CCGGCGCTTTCACGACATGGAACATCTCGAGATGTTCCATGTCGTGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-2443s1c1
Sequence:CCGGCGGAGAACTATAACGAAGCCACTCGAGTGGCTTCGTTATAGTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-1517s1c1
Sequence:CCGGCCCTCTAGGTTATTATGACATCTCGAGATGTCATAATAACCTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031867
TAS1R1 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 1, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-2609s1c1
Sequence:CCGGCCTCCCTAAATGCTACGTGATCTCGAGATCACGTAGCATTTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-2599s1c1
Sequence:CCGGGCGGCTATTTCCTCCCTAAATCTCGAGATTTAGGGAGGAAATAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-1289s1c1
Sequence:CCGGCGCTTTCACGACATGGAACATCTCGAGATGTTCCATGTCGTGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-2443s1c1
Sequence:CCGGCGGAGAACTATAACGAAGCCACTCGAGTGGCTTCGTTATAGTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031867.1-1517s1c1
Sequence:CCGGCCCTCTAGGTTATTATGACATCTCGAGATGTCATAATAACCTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks