EMAIL THIS PAGE TO A FRIEND

TAS1R2

taste receptor, type 1, member 2

Synonyms: GPR71 T1R2 TR2
UniProtKB ID: Q8TE23, Q5TZ19
Gene ID:
Mouse(83770) taste receptor, type 1, member 2
Rat(100270683) taste receptor, type 1, member 2
cow(529847) taste receptor, type 1, member 2
domestic guinea pig(100726121) taste receptor, type 1, member 2
dog(478213) taste receptor, type 1, member 2
domestic cat(100736559) taste receptor, type 1, member 2 pseudogene
Horse(100913083) taste receptor, type 1, member 2
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152232 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152232 Rosetta Predictions human pricing
NM_031873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365730 predicted 1438
2 SASI_Hs01_00020103 predicted 2034
3 SASI_Hs01_00020104 predicted 1841
4 SASI_Hs01_00020105 predicted 445
5 SASI_Hs01_00020106 predicted 1745
6 SASI_Hs01_00020107 predicted 452
7 SASI_Hs01_00020108 predicted 633
8 SASI_Hs01_00020109 predicted 1613
9 SASI_Hs01_00020110 predicted 1468
10 SASI_Hs02_00365731 predicted 2134
11 SASI_Hs01_00020102 predicted 409
12 SASI_Hs01_00020111 predicted 1923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156724 predicted 1998
2 SASI_Mm01_00156725 predicted 519
3 SASI_Mm02_00337186 predicted 2298
4 SASI_Mm01_00156726 predicted 1195
5 SASI_Mm01_00156727 predicted 445
6 SASI_Mm01_00156728 predicted 728
7 SASI_Mm01_00156729 predicted 1148
8 SASI_Mm01_00156731 predicted 374
9 SASI_Mm01_00156732 predicted 1069
10 SASI_Mm01_00156733 predicted 210
11 SASI_Mm01_00156730 predicted 1936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152232
TAS1R2 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 1, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152232.1-128s1c1
Sequence:CCGGGCCAACATGAAGGGCATTGTTCTCGAGAACAATGCCCTTCATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152232.1-2290s1c1
Sequence:CCGGCCTCAGCATGACCTTCTATTTCTCGAGAAATAGAAGGTCATGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152232.1-1915s1c1
Sequence:CCGGCCTCTGCTTCACAATTTGCATCTCGAGATGCAAATTGTGAAGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152232.1-2033s1c1
Sequence:CCGGCCCTACGTCTCTATGGCATTTCTCGAGAAATGCCATAGAGACGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152232.2-2035s21c1
Sequence:CCGGCTACGTCTCTATGGCATTTATCTCGAGATAAATGCCATAGAGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152232.2-603s21c1
Sequence:CCGGTCCGCTGGAACTGGATCATTGCTCGAGCAATGATCCAGTTCCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152232.2-453s21c1
Sequence:CCGGCCAACTTCCTCTCCCTATTTCCTCGAGGAAATAGGGAGAGGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152232
TAS1R2 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 1, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152232.1-128s1c1
Sequence:CCGGGCCAACATGAAGGGCATTGTTCTCGAGAACAATGCCCTTCATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152232.1-2290s1c1
Sequence:CCGGCCTCAGCATGACCTTCTATTTCTCGAGAAATAGAAGGTCATGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152232.1-1915s1c1
Sequence:CCGGCCTCTGCTTCACAATTTGCATCTCGAGATGCAAATTGTGAAGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152232.1-2033s1c1
Sequence:CCGGCCCTACGTCTCTATGGCATTTCTCGAGAAATGCCATAGAGACGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152232.2-2035s21c1
Sequence:CCGGCTACGTCTCTATGGCATTTATCTCGAGATAAATGCCATAGAGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152232.2-603s21c1
Sequence:CCGGTCCGCTGGAACTGGATCATTGCTCGAGCAATGATCCAGTTCCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152232.2-453s21c1
Sequence:CCGGCCAACTTCCTCTCCCTATTTCCTCGAGGAAATAGGGAGAGGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152232
TAS1R2 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 1, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152232.1-128s1c1
Sequence:CCGGGCCAACATGAAGGGCATTGTTCTCGAGAACAATGCCCTTCATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152232.1-2290s1c1
Sequence:CCGGCCTCAGCATGACCTTCTATTTCTCGAGAAATAGAAGGTCATGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152232.1-1915s1c1
Sequence:CCGGCCTCTGCTTCACAATTTGCATCTCGAGATGCAAATTGTGAAGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152232.1-2033s1c1
Sequence:CCGGCCCTACGTCTCTATGGCATTTCTCGAGAAATGCCATAGAGACGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152232.2-2035s21c1
Sequence:CCGGCTACGTCTCTATGGCATTTATCTCGAGATAAATGCCATAGAGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152232.2-603s21c1
Sequence:CCGGTCCGCTGGAACTGGATCATTGCTCGAGCAATGATCCAGTTCCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152232.2-453s21c1
Sequence:CCGGCCAACTTCCTCTCCCTATTTCCTCGAGGAAATAGGGAGAGGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031873
TAS1R2 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 1, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031873.1-412s1c1
Sequence:CCGGCCTCAAAGACTACAGCCAGTACTCGAGTACTGGCTGTAGTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031873.1-2503s1c1
Sequence:CCGGGCGCAACACTTCAGCTTATTTCTCGAGAAATAAGCTGAAGTGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031873.1-2663s1c1
Sequence:CCGGGCTCTTGAAATTACCCATAATCTCGAGATTATGGGTAATTTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031873.1-1624s1c1
Sequence:CCGGCCGATCAGTAGATGAGTTTAACTCGAGTTAAACTCATCTACTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031873.1-208s1c1
Sequence:CCGGGCCCAAGTGCAATGAGTACAACTCGAGTTGTACTCATTGCACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031873
TAS1R2 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 1, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031873.1-412s1c1
Sequence:CCGGCCTCAAAGACTACAGCCAGTACTCGAGTACTGGCTGTAGTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031873.1-2503s1c1
Sequence:CCGGGCGCAACACTTCAGCTTATTTCTCGAGAAATAAGCTGAAGTGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031873.1-2663s1c1
Sequence:CCGGGCTCTTGAAATTACCCATAATCTCGAGATTATGGGTAATTTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031873.1-1624s1c1
Sequence:CCGGCCGATCAGTAGATGAGTTTAACTCGAGTTAAACTCATCTACTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031873.1-208s1c1
Sequence:CCGGGCCCAAGTGCAATGAGTACAACTCGAGTTGTACTCATTGCACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031873
TAS1R2 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 1, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031873.1-412s1c1
Sequence:CCGGCCTCAAAGACTACAGCCAGTACTCGAGTACTGGCTGTAGTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031873.1-2503s1c1
Sequence:CCGGGCGCAACACTTCAGCTTATTTCTCGAGAAATAAGCTGAAGTGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031873.1-2663s1c1
Sequence:CCGGGCTCTTGAAATTACCCATAATCTCGAGATTATGGGTAATTTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031873.1-1624s1c1
Sequence:CCGGCCGATCAGTAGATGAGTTTAACTCGAGTTAAACTCATCTACTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031873.1-208s1c1
Sequence:CCGGGCCCAAGTGCAATGAGTACAACTCGAGTTGTACTCATTGCACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks