EMAIL THIS PAGE TO A FRIEND

TAS1R3

taste receptor, type 1, member 3

Synonyms: T1R3
UniProtKB ID: Q7RTX0, Q5TA49, Q8NGW9
Gene ID:
Human(83756) Summary: The TAS1R3 gene encodes the human homolog of mouse Sac, a major determinant of differences between sweet-sensitive and -insensitive mouse strains in their responsiveness to sucrose, saccharine, and other sweeteners (Max et al., 2001 [PubMed 11326277]
Mouse(83771) taste receptor, type 1, member 3
Rat(170634) taste receptor, type 1, member 3
Zebrafish(562318) taste receptor, type 1, member 3
dog(489594) taste receptor, type 1, member 3
domestic cat(100136905) taste receptor, type 1, member 3
chicken(428182) taste receptor, type 1, member 3
cow(511517) taste receptor, type 1, member 3
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152228 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152228 Rosetta Predictions human pricing
NM_130818 Rosetta Predictions rat pricing
NM_031872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168581 predicted 1436
2 SASI_Hs01_00168582 predicted 1128
3 SASI_Hs02_00365725 predicted 1167
4 SASI_Hs01_00168583 predicted 368
5 SASI_Hs01_00168584 predicted 1117
6 SASI_Hs01_00168585 predicted 1341
7 SASI_Hs01_00168586 predicted 1441
8 SASI_Hs01_00168587 predicted 1152
9 SASI_Hs01_00168588 predicted 1320
10 SASI_Hs01_00168589 predicted 1164
11 SASI_Hs01_00168580 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130818 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047390 predicted 1107
2 SASI_Rn01_00047391 predicted 1302
3 SASI_Rn01_00047392 predicted 1191
4 SASI_Rn01_00047393 predicted 2017
5 SASI_Rn01_00047394 predicted 1181
6 SASI_Rn01_00047395 predicted 734
7 SASI_Rn01_00047396 predicted 585
8 SASI_Rn02_00267510 predicted 2230
9 SASI_Rn01_00047397 predicted 1538
10 SASI_Rn01_00047398 predicted 1262
11 SASI_Rn01_00047399 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071168 predicted 1176
2 SASI_Mm01_00071169 predicted 1020
3 SASI_Mm01_00071170 predicted 1207
4 SASI_Mm01_00071171 predicted 1195
5 SASI_Mm01_00071172 predicted 935
6 SASI_Mm01_00071173 predicted 1198
7 SASI_Mm01_00071174 predicted 1360
8 SASI_Mm01_00071175 predicted 599
9 SASI_Mm01_00071176 predicted 716
10 SASI_Mm01_00071177 predicted 2580
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031872
TAS1R3 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 1, member 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031872.2-2624s21c1
Sequence:CCGGGAACCTAGCCCTACCAGAAATCTCGAGATTTCTGGTAGGGCTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-1560s1c1
Sequence:CCGGGCCGAGTAAAGGGCTTTCATTCTCGAGAATGAAAGCCCTTTACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-1428s1c1
Sequence:CCGGGCCCTACACCTGTATTACATACTCGAGTATGTAATACAGGTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-306s1c1
Sequence:CCGGGCTATGACCTATTTGACACATCTCGAGATGTGTCAAATAGGTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-2469s1c1
Sequence:CCGGCCAAGTGCTATGTGCTTCTTTCTCGAGAAAGAAGCACATAGCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-2233s1c1
Sequence:CCGGGCACATCACCAATGCAATGTTCTCGAGAACATTGCATTGGTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031872
TAS1R3 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 1, member 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031872.2-2624s21c1
Sequence:CCGGGAACCTAGCCCTACCAGAAATCTCGAGATTTCTGGTAGGGCTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-1560s1c1
Sequence:CCGGGCCGAGTAAAGGGCTTTCATTCTCGAGAATGAAAGCCCTTTACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-1428s1c1
Sequence:CCGGGCCCTACACCTGTATTACATACTCGAGTATGTAATACAGGTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-306s1c1
Sequence:CCGGGCTATGACCTATTTGACACATCTCGAGATGTGTCAAATAGGTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-2469s1c1
Sequence:CCGGCCAAGTGCTATGTGCTTCTTTCTCGAGAAAGAAGCACATAGCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-2233s1c1
Sequence:CCGGGCACATCACCAATGCAATGTTCTCGAGAACATTGCATTGGTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031872
TAS1R3 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 1, member 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031872.2-2624s21c1
Sequence:CCGGGAACCTAGCCCTACCAGAAATCTCGAGATTTCTGGTAGGGCTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-1560s1c1
Sequence:CCGGGCCGAGTAAAGGGCTTTCATTCTCGAGAATGAAAGCCCTTTACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-1428s1c1
Sequence:CCGGGCCCTACACCTGTATTACATACTCGAGTATGTAATACAGGTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-306s1c1
Sequence:CCGGGCTATGACCTATTTGACACATCTCGAGATGTGTCAAATAGGTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-2469s1c1
Sequence:CCGGCCAAGTGCTATGTGCTTCTTTCTCGAGAAAGAAGCACATAGCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031872.1-2233s1c1
Sequence:CCGGGCACATCACCAATGCAATGTTCTCGAGAACATTGCATTGGTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152228
TAS1R3 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 1, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-1175s21c1
Sequence:CCGGCTGTCTACGCAGCTGTGTATACTCGAGTATACACAGCTGCGTAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-2315s21c1
Sequence:CCGGTCATCACCTGGGTCTCCTTTGCTCGAGCAAAGGAGACCCAGGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-69s21c1
Sequence:CCGGGTGCCTGTCACAGCAACTTAGCTCGAGCTAAGTTGCTGTGACAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-246s21c1
Sequence:CCGGGATCAACAACAAGTCGGATCTCTCGAGAGATCCGACTTGTTGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-184s21c1
Sequence:CCGGTGCACCAGGTTCTCCTCAAACCTCGAGGTTTGAGGAGAACCTGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152228
TAS1R3 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 1, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-1175s21c1
Sequence:CCGGCTGTCTACGCAGCTGTGTATACTCGAGTATACACAGCTGCGTAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-2315s21c1
Sequence:CCGGTCATCACCTGGGTCTCCTTTGCTCGAGCAAAGGAGACCCAGGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-69s21c1
Sequence:CCGGGTGCCTGTCACAGCAACTTAGCTCGAGCTAAGTTGCTGTGACAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-246s21c1
Sequence:CCGGGATCAACAACAAGTCGGATCTCTCGAGAGATCCGACTTGTTGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-184s21c1
Sequence:CCGGTGCACCAGGTTCTCCTCAAACCTCGAGGTTTGAGGAGAACCTGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152228
TAS1R3 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 1, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-1175s21c1
Sequence:CCGGCTGTCTACGCAGCTGTGTATACTCGAGTATACACAGCTGCGTAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-2315s21c1
Sequence:CCGGTCATCACCTGGGTCTCCTTTGCTCGAGCAAAGGAGACCCAGGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-69s21c1
Sequence:CCGGGTGCCTGTCACAGCAACTTAGCTCGAGCTAAGTTGCTGTGACAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-246s21c1
Sequence:CCGGGATCAACAACAAGTCGGATCTCTCGAGAGATCCGACTTGTTGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152228.1-184s21c1
Sequence:CCGGTGCACCAGGTTCTCCTCAAACCTCGAGGTTTGAGGAGAACCTGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks