EMAIL THIS PAGE TO A FRIEND

TAS2R10

taste receptor, type 2, member 10

Synonyms: T2R10 TRB2
UniProtKB ID: Q9NYW0, Q3MIM9, Q6NTD9
Gene ID:
Human(50839) Summary: This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
cow(664636) taste receptor, type 2, member 10
dog(100271734) taste receptor, type 2, member 10
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023921 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010191 MISSION® esiRNA esiRNA targeting human TAS2R10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023921 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078990 predicted 467
2 SASI_Hs01_00078991 predicted 402
3 SASI_Hs01_00078992 predicted 553
4 SASI_Hs01_00078993 predicted 602
5 SASI_Hs01_00078995 predicted 232
6 SASI_Hs01_00078996 predicted 370
7 SASI_Hs01_00078997 predicted 440
8 SASI_Hs01_00078998 predicted 428
9 SASI_Hs01_00078999 predicted 227
10 SASI_Hs02_00356377 predicted 476
11 SASI_Hs01_00078994 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023921
TAS2R10 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023921.1-72s21c1
Sequence:CCGGTGGATTTATTGGACTTGTAAACTCGAGTTTACAAGTCCAATAAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023921.1-261s21c1
Sequence:CCGGTTGGGTAATTGGTAATCAATCCTCGAGGATTGATTACCAATTACCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-230s1c1
Sequence:CCGGCCGGTAACCTAATTGAATATACTCGAGTATATTCAATTAGGTTACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-661s1c1
Sequence:CCGGGCTCATGTGAAGGCAATGAAACTCGAGTTTCATTGCCTTCACATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-95s1c1
Sequence:CCGGGCATTGACTGTGCCAAGAATACTCGAGTATTCTTGGCACAGTCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-725s1c1
Sequence:CCGGGCATGGCCATAGAAATATCATCTCGAGATGATATTTCTATGGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-388s1c1
Sequence:CCGGCCCTTCATGATAGTATTCTTACTCGAGTAAGAATACTATCATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023921
TAS2R10 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023921.1-72s21c1
Sequence:CCGGTGGATTTATTGGACTTGTAAACTCGAGTTTACAAGTCCAATAAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023921.1-261s21c1
Sequence:CCGGTTGGGTAATTGGTAATCAATCCTCGAGGATTGATTACCAATTACCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-230s1c1
Sequence:CCGGCCGGTAACCTAATTGAATATACTCGAGTATATTCAATTAGGTTACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-661s1c1
Sequence:CCGGGCTCATGTGAAGGCAATGAAACTCGAGTTTCATTGCCTTCACATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-95s1c1
Sequence:CCGGGCATTGACTGTGCCAAGAATACTCGAGTATTCTTGGCACAGTCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-725s1c1
Sequence:CCGGGCATGGCCATAGAAATATCATCTCGAGATGATATTTCTATGGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-388s1c1
Sequence:CCGGCCCTTCATGATAGTATTCTTACTCGAGTAAGAATACTATCATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023921
TAS2R10 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023921.1-72s21c1
Sequence:CCGGTGGATTTATTGGACTTGTAAACTCGAGTTTACAAGTCCAATAAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023921.1-261s21c1
Sequence:CCGGTTGGGTAATTGGTAATCAATCCTCGAGGATTGATTACCAATTACCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-230s1c1
Sequence:CCGGCCGGTAACCTAATTGAATATACTCGAGTATATTCAATTAGGTTACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-661s1c1
Sequence:CCGGGCTCATGTGAAGGCAATGAAACTCGAGTTTCATTGCCTTCACATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-95s1c1
Sequence:CCGGGCATTGACTGTGCCAAGAATACTCGAGTATTCTTGGCACAGTCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-725s1c1
Sequence:CCGGGCATGGCCATAGAAATATCATCTCGAGATGATATTTCTATGGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023921.1-388s1c1
Sequence:CCGGCCCTTCATGATAGTATTCTTACTCGAGTAAGAATACTATCATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks