EMAIL THIS PAGE TO A FRIEND

TAS2R13

taste receptor, type 2, member 13

Synonyms: T2R13 TRB3
UniProtKB ID: Q9NYV9, Q4G0I5, Q502V8, Q645X2
Gene ID:
Human(50838) Summary: This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Rat(78984) taste receptor, type 2, member 13
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023920 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023920 Rosetta Predictions human pricing
NM_023998 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120766 predicted 319
2 SASI_Hs01_00120767 predicted 556
3 SASI_Hs01_00120768 predicted 1102
4 SASI_Hs01_00120769 predicted 1048
5 SASI_Hs01_00120770 predicted 748
6 SASI_Hs01_00120772 predicted 1207
7 SASI_Hs02_00356375 predicted 790
8 SASI_Hs02_00356376 predicted 275
9 SASI_Hs01_00120773 predicted 736
10 SASI_Hs01_00120775 predicted 763
11 SASI_Hs01_00120771 predicted 335
12 SASI_Hs01_00120774 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114490 predicted 483
2 SASI_Rn01_00114491 predicted 530
3 SASI_Rn01_00114492 predicted 454
4 SASI_Rn01_00114494 predicted 673
5 SASI_Rn01_00114495 predicted 207
6 SASI_Rn01_00114496 predicted 422
7 SASI_Rn01_00114497 predicted 482
8 SASI_Rn02_00263834 predicted 211
9 SASI_Rn02_00263835 predicted 711
10 SASI_Rn02_00263836 predicted 462
11 SASI_Rn01_00114489 predicted 594
12 SASI_Rn01_00114493 predicted 374
13 SASI_Rn01_00114498 predicted 200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023920
TAS2R13 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 13
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023920.1-298s1c1
Sequence:CCGGGCTACAATCTTCAGCATCTTTCTCGAGAAAGATGCTGAAGATTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023920.1-128s1c1
Sequence:CCGGCAGTCGATAAACTCCTCATTACTCGAGTAATGAGGAGTTTATCGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023920.1-533s1c1
Sequence:CCGGCGGTCAAATTCACTATGACTACTCGAGTAGTCATAGTGAATTTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023920.1-724s1c1
Sequence:CCGGGCTAGTTTCTTTCTATGTGTTCTCGAGAACACATAGAAAGAAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023920.2-819s21c1
Sequence:CCGGGTTCAGTCTAACACCATTTACCTCGAGGTAAATGGTGTTAGACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023920.2-438s21c1
Sequence:CCGGGATCTGGGAAATATTAGTAAGCTCGAGCTTACTAATATTTCCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023920
TAS2R13 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 13
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023920.1-298s1c1
Sequence:CCGGGCTACAATCTTCAGCATCTTTCTCGAGAAAGATGCTGAAGATTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023920.1-128s1c1
Sequence:CCGGCAGTCGATAAACTCCTCATTACTCGAGTAATGAGGAGTTTATCGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023920.1-533s1c1
Sequence:CCGGCGGTCAAATTCACTATGACTACTCGAGTAGTCATAGTGAATTTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023920.1-724s1c1
Sequence:CCGGGCTAGTTTCTTTCTATGTGTTCTCGAGAACACATAGAAAGAAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023920.2-819s21c1
Sequence:CCGGGTTCAGTCTAACACCATTTACCTCGAGGTAAATGGTGTTAGACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023920.2-438s21c1
Sequence:CCGGGATCTGGGAAATATTAGTAAGCTCGAGCTTACTAATATTTCCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023920
TAS2R13 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 13
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023920.1-298s1c1
Sequence:CCGGGCTACAATCTTCAGCATCTTTCTCGAGAAAGATGCTGAAGATTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023920.1-128s1c1
Sequence:CCGGCAGTCGATAAACTCCTCATTACTCGAGTAATGAGGAGTTTATCGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023920.1-533s1c1
Sequence:CCGGCGGTCAAATTCACTATGACTACTCGAGTAGTCATAGTGAATTTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023920.1-724s1c1
Sequence:CCGGGCTAGTTTCTTTCTATGTGTTCTCGAGAACACATAGAAAGAAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023920.2-819s21c1
Sequence:CCGGGTTCAGTCTAACACCATTTACCTCGAGGTAAATGGTGTTAGACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023920.2-438s21c1
Sequence:CCGGGATCTGGGAAATATTAGTAAGCTCGAGCTTACTAATATTTCCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks