EMAIL THIS PAGE TO A FRIEND

TAS2R14

taste receptor, type 2, member 14

Synonyms: T2R14 TRB1
Species: Human TAS2R14(50840)
UniProtKB ID: Q9NYV8, Q645X3
Gene ID:
Human(50840) Summary: This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502089 Anti-TAS2R14 antibody produced in rabbit affinity isolated antibody human
pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023922 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU230201 MISSION® esiRNA esiRNA targeting human TAS2R14 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023922 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188682 predicted 449
2 SASI_Hs01_00188683 predicted 487
3 SASI_Hs01_00188684 predicted 570
4 SASI_Hs01_00188685 predicted 292
5 SASI_Hs01_00188686 predicted 632
6 SASI_Hs01_00188687 predicted 209
7 SASI_Hs01_00188688 predicted 452
8 SASI_Hs01_00188689 predicted 496
9 SASI_Hs01_00188690 predicted 432
10 SASI_Hs02_00356378 predicted 531
11 SASI_Hs01_00188681 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023922
TAS2R14 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 14
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023922.1-436s1c1
Sequence:CCGGGCACTGATAAACATCCATATACTCGAGTATATGGATGTTTATCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023922.1-461s1c1
Sequence:CCGGCCAGTATCAATGGATACAGAACTCGAGTTCTGTATCCATTGATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023922.1-217s1c1
Sequence:CCGGCCAGCTTTATTTGCCACTGAACTCGAGTTCAGTGGCAAATAAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023922.1-699s1c1
Sequence:CCGGGATCACTTTCTTCCTACTCTACTCGAGTAGAGTAGGAAGAAAGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023922.1-542s21c1
Sequence:CCGGTAACCAGCACTGTGTTCATTTCTCGAGAAATGAACACAGTGCTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023922.1-497s21c1
Sequence:CCGGGTTCTGATTCAAGTAACTTTACTCGAGTAAAGTTACTTGAATCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023922
TAS2R14 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 14
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023922.1-436s1c1
Sequence:CCGGGCACTGATAAACATCCATATACTCGAGTATATGGATGTTTATCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023922.1-461s1c1
Sequence:CCGGCCAGTATCAATGGATACAGAACTCGAGTTCTGTATCCATTGATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023922.1-217s1c1
Sequence:CCGGCCAGCTTTATTTGCCACTGAACTCGAGTTCAGTGGCAAATAAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023922.1-699s1c1
Sequence:CCGGGATCACTTTCTTCCTACTCTACTCGAGTAGAGTAGGAAGAAAGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023922.1-542s21c1
Sequence:CCGGTAACCAGCACTGTGTTCATTTCTCGAGAAATGAACACAGTGCTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023922.1-497s21c1
Sequence:CCGGGTTCTGATTCAAGTAACTTTACTCGAGTAAAGTTACTTGAATCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023922
TAS2R14 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 14
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023922.1-436s1c1
Sequence:CCGGGCACTGATAAACATCCATATACTCGAGTATATGGATGTTTATCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023922.1-461s1c1
Sequence:CCGGCCAGTATCAATGGATACAGAACTCGAGTTCTGTATCCATTGATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023922.1-217s1c1
Sequence:CCGGCCAGCTTTATTTGCCACTGAACTCGAGTTCAGTGGCAAATAAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023922.1-699s1c1
Sequence:CCGGGATCACTTTCTTCCTACTCTACTCGAGTAGAGTAGGAAGAAAGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023922.1-542s21c1
Sequence:CCGGTAACCAGCACTGTGTTCATTTCTCGAGAAATGAACACAGTGCTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023922.1-497s21c1
Sequence:CCGGGTTCTGATTCAAGTAACTTTACTCGAGTAAAGTTACTTGAATCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks