EMAIL THIS PAGE TO A FRIEND

TAS2R16

taste receptor, type 2, member 16

Synonyms: T2R16
UniProtKB ID: Q9NYV7, A4D0X2, Q502V3, Q549U8, Q645W1
Gene ID:
Human(50833) Summary: This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily. These family members are specifically expressed by taste receptor cells of the tongue and palate epithelia. Each of these apparently intronless genes encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes in chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008]
cow(664638) taste receptor, type 2, member 16
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502083 Anti-TAS2R16 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016945 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004631 MISSION® esiRNA esiRNA targeting human TAS2R16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016945 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081529 predicted 375
2 SASI_Hs01_00081530 predicted 680
3 SASI_Hs01_00081531 predicted 332
4 SASI_Hs01_00081532 predicted 245
5 SASI_Hs01_00081533 predicted 555
6 SASI_Hs01_00081534 predicted 460
7 SASI_Hs02_00349946 predicted 217
8 SASI_Hs01_00081535 predicted 602
9 SASI_Hs01_00081537 predicted 496
10 SASI_Hs02_00349947 predicted 446
11 SASI_Hs01_00081536 predicted 618
12 SASI_Hs01_00081538 predicted 544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016945
TAS2R16 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 16
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-688s1c1
Sequence:CCGGGCCGTCTTATTTATTGTGTTTCTCGAGAAACACAATAAATAAGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-129s1c1
Sequence:CCGGGCCTGTGGACATGATTCTCATCTCGAGATGAGAATCATGTCCACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-45s1c1
Sequence:CCGGGCTTGAGTCCTTGACAATTATCTCGAGATAATTGTCAAGGACTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-534s1c1
Sequence:CCGGCCAGGCTCATACAGTTGCATTCTCGAGAATGCAACTGTATGAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-426s1c1
Sequence:CCGGCCCTTCAGCTATTGGGAATTACTCGAGTAATTCCCAATAGCTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016945.2-743s21c1
Sequence:CCGGTGAGGTCCCTTGCCGTCTTATCTCGAGATAAGACGGCAAGGGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016945.2-790s21c1
Sequence:CCGGACCATACTCATCACCATTATACTCGAGTATAATGGTGATGAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016945.2-131s21c1
Sequence:CCGGTTGTGCAGAGCAGCCTAATTGCTCGAGCAATTAGGCTGCTCTGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016945
TAS2R16 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 16
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-688s1c1
Sequence:CCGGGCCGTCTTATTTATTGTGTTTCTCGAGAAACACAATAAATAAGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-129s1c1
Sequence:CCGGGCCTGTGGACATGATTCTCATCTCGAGATGAGAATCATGTCCACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-45s1c1
Sequence:CCGGGCTTGAGTCCTTGACAATTATCTCGAGATAATTGTCAAGGACTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-534s1c1
Sequence:CCGGCCAGGCTCATACAGTTGCATTCTCGAGAATGCAACTGTATGAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-426s1c1
Sequence:CCGGCCCTTCAGCTATTGGGAATTACTCGAGTAATTCCCAATAGCTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016945.2-743s21c1
Sequence:CCGGTGAGGTCCCTTGCCGTCTTATCTCGAGATAAGACGGCAAGGGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016945.2-790s21c1
Sequence:CCGGACCATACTCATCACCATTATACTCGAGTATAATGGTGATGAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016945.2-131s21c1
Sequence:CCGGTTGTGCAGAGCAGCCTAATTGCTCGAGCAATTAGGCTGCTCTGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016945
TAS2R16 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 16
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-688s1c1
Sequence:CCGGGCCGTCTTATTTATTGTGTTTCTCGAGAAACACAATAAATAAGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-129s1c1
Sequence:CCGGGCCTGTGGACATGATTCTCATCTCGAGATGAGAATCATGTCCACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-45s1c1
Sequence:CCGGGCTTGAGTCCTTGACAATTATCTCGAGATAATTGTCAAGGACTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-534s1c1
Sequence:CCGGCCAGGCTCATACAGTTGCATTCTCGAGAATGCAACTGTATGAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016945.1-426s1c1
Sequence:CCGGCCCTTCAGCTATTGGGAATTACTCGAGTAATTCCCAATAGCTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016945.2-743s21c1
Sequence:CCGGTGAGGTCCCTTGCCGTCTTATCTCGAGATAAGACGGCAAGGGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016945.2-790s21c1
Sequence:CCGGACCATACTCATCACCATTATACTCGAGTATAATGGTGATGAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016945.2-131s21c1
Sequence:CCGGTTGTGCAGAGCAGCCTAATTGCTCGAGCAATTAGGCTGCTCTGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks