EMAIL THIS PAGE TO A FRIEND

TAS2R19

taste receptor, type 2, member 19

Synonyms: MSTP058 T2R19 T2R23 T2R48 TAS2R23 TAS2R48
Species: Human TAS2R19(259294)
UniProtKB ID: P59542, Q3MIJ4, Q645X8
Gene ID:
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176888 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU230521 MISSION® esiRNA esiRNA targeting human TAS2R19 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176888 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241561 predicted 243
2 SASI_Hs01_00241567 predicted 524
3 SASI_Hs02_00369277 predicted 256
4 SASI_Hs02_00369278 predicted 786
5 SASI_Hs02_00369279 predicted 766
6 SASI_Hs02_00369280 predicted 794
7 SASI_Hs02_00369281 predicted 174
8 SASI_Hs02_00369282 predicted 176
9 SASI_Hs02_00369283 predicted 737
10 SASI_Hs02_00369284 predicted 716
11 SASI_Hs01_00241558 predicted 208
12 SASI_Hs01_00241559 predicted 515
13 SASI_Hs01_00241560 predicted 349
14 SASI_Hs01_00241562 predicted 438
15 SASI_Hs01_00241563 predicted 344
16 SASI_Hs01_00241564 predicted 373
17 SASI_Hs01_00241565 predicted 509
18 SASI_Hs01_00241566 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176888
TAS2R19 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 19
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176888.1-227s21c1
Sequence:CCGGATGGTTTAGAAGTAAGAATTGCTCGAGCAATTCTTACTTCTAAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176888.1-358s21c1
Sequence:CCGGCACCTAAAGAAGAGAATTAAGCTCGAGCTTAATTCTCTTCTTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176888.1-31s21c1
Sequence:CCGGATTCTGGTAGTGTTTGCATTTCTCGAGAAATGCAAACACTACCAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-559s1c1
Sequence:CCGGCCCTTTACTCTGAGCCTAATACTCGAGTATTAGGCTCAGAGTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-192s1c1
Sequence:CCGGCCTTTGGTATGCAACTGTGTTCTCGAGAACACAGTTGCATACCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-531s1c1
Sequence:CCGGGACTGTAACTACTCTAGCAAACTCGAGTTTGCTAGAGTAGTTACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-181s1c1
Sequence:CCGGGTCATGTTATTCCTTTGGTATCTCGAGATACCAAAGGAATAACATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-715s1c1
Sequence:CCGGGCCATTTACTTTCTGTGTATACTCGAGTATACACAGAAAGTAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176888
TAS2R19 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 19
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176888.1-227s21c1
Sequence:CCGGATGGTTTAGAAGTAAGAATTGCTCGAGCAATTCTTACTTCTAAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176888.1-358s21c1
Sequence:CCGGCACCTAAAGAAGAGAATTAAGCTCGAGCTTAATTCTCTTCTTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176888.1-31s21c1
Sequence:CCGGATTCTGGTAGTGTTTGCATTTCTCGAGAAATGCAAACACTACCAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-559s1c1
Sequence:CCGGCCCTTTACTCTGAGCCTAATACTCGAGTATTAGGCTCAGAGTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-192s1c1
Sequence:CCGGCCTTTGGTATGCAACTGTGTTCTCGAGAACACAGTTGCATACCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-531s1c1
Sequence:CCGGGACTGTAACTACTCTAGCAAACTCGAGTTTGCTAGAGTAGTTACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-181s1c1
Sequence:CCGGGTCATGTTATTCCTTTGGTATCTCGAGATACCAAAGGAATAACATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-715s1c1
Sequence:CCGGGCCATTTACTTTCTGTGTATACTCGAGTATACACAGAAAGTAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176888
TAS2R19 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 19
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176888.1-227s21c1
Sequence:CCGGATGGTTTAGAAGTAAGAATTGCTCGAGCAATTCTTACTTCTAAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176888.1-358s21c1
Sequence:CCGGCACCTAAAGAAGAGAATTAAGCTCGAGCTTAATTCTCTTCTTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176888.1-31s21c1
Sequence:CCGGATTCTGGTAGTGTTTGCATTTCTCGAGAAATGCAAACACTACCAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-559s1c1
Sequence:CCGGCCCTTTACTCTGAGCCTAATACTCGAGTATTAGGCTCAGAGTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-192s1c1
Sequence:CCGGCCTTTGGTATGCAACTGTGTTCTCGAGAACACAGTTGCATACCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-531s1c1
Sequence:CCGGGACTGTAACTACTCTAGCAAACTCGAGTTTGCTAGAGTAGTTACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-181s1c1
Sequence:CCGGGTCATGTTATTCCTTTGGTATCTCGAGATACCAAAGGAATAACATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176888.1-715s1c1
Sequence:CCGGGCCATTTACTTTCTGTGTATACTCGAGTATACACAGAAAGTAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks