EMAIL THIS PAGE TO A FRIEND

TAS2R1

taste receptor, type 2, member 1

Synonyms: T2R1 TRB7
UniProtKB ID: Q9NYW7, Q646G8
Gene ID:
Human(50834) Summary: This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily and that are specifically expressed by taste receptor cells of the tongue and palate epithelia. This intronless taste receptor gene encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is mapped to chromosome 5p15, the location of a genetic locus (PROP) that controls the detection of the bitter compound 6-n-propyl-2-thiouracil. [provided by RefSeq, Jul 2008]
dog(100271742) taste receptor, type 2, member 1
cow(664649) taste receptor, type 2, member 1
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019599 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142701 MISSION® esiRNA esiRNA human TAS2R1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019599 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088314 predicted 1079
2 SASI_Hs01_00088315 predicted 759
3 SASI_Hs01_00088316 predicted 756
4 SASI_Hs01_00088317 predicted 818
5 SASI_Hs01_00088319 predicted 711
6 SASI_Hs01_00088320 predicted 549
7 SASI_Hs01_00088321 predicted 857
8 SASI_Hs01_00088322 predicted 714
9 SASI_Hs01_00088323 predicted 537
10 SASI_Hs02_00352801 predicted 1109
11 SASI_Hs01_00088318 predicted 596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019599
TAS2R1 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-430s1c1
Sequence:CCGGCATAGCAAATATGCAGGGTTTCTCGAGAAACCCTGCATATTTGCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-554s1c1
Sequence:CCGGTGCCATTGCTTATCTTCCTTTCTCGAGAAAGGAAGATAAGCAATGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-42s1c1
Sequence:CCGGGATACAATTTCTTCTTGGGATCTCGAGATCCCAAGAAGAAATTGTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-177s1c1
Sequence:CCGGGTTGTTCATCTTCTACGTTAACTCGAGTTAACGTAGAAGATGAACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-678s1c1
Sequence:CCGGGTTGCTGTCTATCCTGTCCTTCTCGAGAAGGACAGGATAGACAGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019599.2-544s21c1
Sequence:CCGGCATCATGTGTTCTGCGAATTGCTCGAGCAATTCGCAGAACACATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019599.2-1104s21c1
Sequence:CCGGTCATCCTTGTGATTGGTATATCTCGAGATATACCAATCACAAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019599.2-497s21c1
Sequence:CCGGTTGTTCATCTTCTACGTTAATCTCGAGATTAACGTAGAAGATGAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019599.2-349s21c1
Sequence:CCGGTCTTCTTGCAGTGATACAATTCTCGAGAATTGTATCACTGCAAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019599
TAS2R1 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-430s1c1
Sequence:CCGGCATAGCAAATATGCAGGGTTTCTCGAGAAACCCTGCATATTTGCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-554s1c1
Sequence:CCGGTGCCATTGCTTATCTTCCTTTCTCGAGAAAGGAAGATAAGCAATGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-42s1c1
Sequence:CCGGGATACAATTTCTTCTTGGGATCTCGAGATCCCAAGAAGAAATTGTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-177s1c1
Sequence:CCGGGTTGTTCATCTTCTACGTTAACTCGAGTTAACGTAGAAGATGAACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-678s1c1
Sequence:CCGGGTTGCTGTCTATCCTGTCCTTCTCGAGAAGGACAGGATAGACAGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019599.2-544s21c1
Sequence:CCGGCATCATGTGTTCTGCGAATTGCTCGAGCAATTCGCAGAACACATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019599.2-1104s21c1
Sequence:CCGGTCATCCTTGTGATTGGTATATCTCGAGATATACCAATCACAAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019599.2-497s21c1
Sequence:CCGGTTGTTCATCTTCTACGTTAATCTCGAGATTAACGTAGAAGATGAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019599.2-349s21c1
Sequence:CCGGTCTTCTTGCAGTGATACAATTCTCGAGAATTGTATCACTGCAAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019599
TAS2R1 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-430s1c1
Sequence:CCGGCATAGCAAATATGCAGGGTTTCTCGAGAAACCCTGCATATTTGCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-554s1c1
Sequence:CCGGTGCCATTGCTTATCTTCCTTTCTCGAGAAAGGAAGATAAGCAATGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-42s1c1
Sequence:CCGGGATACAATTTCTTCTTGGGATCTCGAGATCCCAAGAAGAAATTGTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-177s1c1
Sequence:CCGGGTTGTTCATCTTCTACGTTAACTCGAGTTAACGTAGAAGATGAACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019599.1-678s1c1
Sequence:CCGGGTTGCTGTCTATCCTGTCCTTCTCGAGAAGGACAGGATAGACAGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019599.2-544s21c1
Sequence:CCGGCATCATGTGTTCTGCGAATTGCTCGAGCAATTCGCAGAACACATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019599.2-1104s21c1
Sequence:CCGGTCATCCTTGTGATTGGTATATCTCGAGATATACCAATCACAAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019599.2-497s21c1
Sequence:CCGGTTGTTCATCTTCTACGTTAATCTCGAGATTAACGTAGAAGATGAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019599.2-349s21c1
Sequence:CCGGTCTTCTTGCAGTGATACAATTCTCGAGAATTGTATCACTGCAAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks