EMAIL THIS PAGE TO A FRIEND

TAS2R20

taste receptor, type 2, member 20

Synonyms: T2R20 T2R49 T2R56 TAS2R49
Species: Human TAS2R20(259295)
UniProtKB ID: P59543, P59549, Q2HIZ4, Q496D8, Q645X9
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176889 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176889 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369285 predicted 457
2 SASI_Hs01_00213423 predicted 372
3 SASI_Hs01_00213424 predicted 438
4 SASI_Hs01_00213425 predicted 581
5 SASI_Hs01_00213426 predicted 467
6 SASI_Hs01_00213427 predicted 535
7 SASI_Hs02_00369286 predicted 217
8 SASI_Hs01_00213429 predicted 366
9 SASI_Hs01_00213431 predicted 425
10 SASI_Hs01_00213432 predicted 213
11 SASI_Hs01_00213428 predicted 217
12 SASI_Hs01_00213430 predicted 260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176889
TAS2R20 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 20
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-260s1c1
Sequence:CCGGCCTGGGCAGTAACCAATCATTCTCGAGAATGATTGGTTACTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-727s1c1
Sequence:CCGGCTGTGTCTAATCATATCGTTTCTCGAGAAACGATATGATTAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-206s1c1
Sequence:CCGGCTGTGTTGAATCCAACTTCATCTCGAGATGAAGTTGGATTCAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-429s1c1
Sequence:CCGGCCTTGTGATGAAACACACGTACTCGAGTACGTGTGTTTCATCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-543s1c1
Sequence:CCGGGCTAGCAAACTTGATACCATTCTCGAGAATGGTATCAAGTTTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176889.2-1375s21c1
Sequence:CCGGGTAATTTGTATCACGTATATGCTCGAGCATATACGTGATACAAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176889.2-1423s21c1
Sequence:CCGGATCATTGTTTGAACCTCTAATCTCGAGATTAGAGGTTCAAACAATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176889.2-1306s21c1
Sequence:CCGGTAAGAACTGACAGCTTATATCCTCGAGGATATAAGCTGTCAGTTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176889
TAS2R20 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 20
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-260s1c1
Sequence:CCGGCCTGGGCAGTAACCAATCATTCTCGAGAATGATTGGTTACTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-727s1c1
Sequence:CCGGCTGTGTCTAATCATATCGTTTCTCGAGAAACGATATGATTAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-206s1c1
Sequence:CCGGCTGTGTTGAATCCAACTTCATCTCGAGATGAAGTTGGATTCAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-429s1c1
Sequence:CCGGCCTTGTGATGAAACACACGTACTCGAGTACGTGTGTTTCATCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-543s1c1
Sequence:CCGGGCTAGCAAACTTGATACCATTCTCGAGAATGGTATCAAGTTTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176889.2-1375s21c1
Sequence:CCGGGTAATTTGTATCACGTATATGCTCGAGCATATACGTGATACAAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176889.2-1423s21c1
Sequence:CCGGATCATTGTTTGAACCTCTAATCTCGAGATTAGAGGTTCAAACAATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176889.2-1306s21c1
Sequence:CCGGTAAGAACTGACAGCTTATATCCTCGAGGATATAAGCTGTCAGTTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176889
TAS2R20 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 20
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-260s1c1
Sequence:CCGGCCTGGGCAGTAACCAATCATTCTCGAGAATGATTGGTTACTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-727s1c1
Sequence:CCGGCTGTGTCTAATCATATCGTTTCTCGAGAAACGATATGATTAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-206s1c1
Sequence:CCGGCTGTGTTGAATCCAACTTCATCTCGAGATGAAGTTGGATTCAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-429s1c1
Sequence:CCGGCCTTGTGATGAAACACACGTACTCGAGTACGTGTGTTTCATCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176889.1-543s1c1
Sequence:CCGGGCTAGCAAACTTGATACCATTCTCGAGAATGGTATCAAGTTTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176889.2-1375s21c1
Sequence:CCGGGTAATTTGTATCACGTATATGCTCGAGCATATACGTGATACAAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176889.2-1423s21c1
Sequence:CCGGATCATTGTTTGAACCTCTAATCTCGAGATTAGAGGTTCAAACAATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176889.2-1306s21c1
Sequence:CCGGTAAGAACTGACAGCTTATATCCTCGAGGATATAAGCTGTCAGTTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks