EMAIL THIS PAGE TO A FRIEND

TAS2R30

taste receptor, type 2, member 30

Synonyms: T2R30 T2R47 TAS2R47
Species: Human TAS2R30(259293)
UniProtKB ID: P59541, Q645X7
Gene ID:
7 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001097643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001097643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001097643 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097643 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318571 predicted 511
2 SASI_Hs02_00318572 predicted 513
3 SASI_Hs02_00318573 predicted 517
4 SASI_Hs02_00318574 predicted 693
5 SASI_Hs02_00318575 predicted 179
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097643
TAS2R30 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 30
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-182s21c1
Sequence:CCGGTGTTATTACTACATTGGTATGCTCGAGCATACCAATGTAGTAATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-730s21c1
Sequence:CCGGTCCATGATCATATCAGTTTGTCTCGAGACAAACTGATATGATCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-519s21c1
Sequence:CCGGCCATTCAAATATGACTCTAACCTCGAGGTTAGAGTCATATTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-784s21c1
Sequence:CCGGATGTTCTGCCAAGCTATTATACTCGAGTATAATAGCTTGGCAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-447s21c1
Sequence:CCGGGGATGAGACTGTATGGACAAACTCGAGTTTGTCCATACAGTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097643
TAS2R30 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 30
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-182s21c1
Sequence:CCGGTGTTATTACTACATTGGTATGCTCGAGCATACCAATGTAGTAATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-730s21c1
Sequence:CCGGTCCATGATCATATCAGTTTGTCTCGAGACAAACTGATATGATCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-519s21c1
Sequence:CCGGCCATTCAAATATGACTCTAACCTCGAGGTTAGAGTCATATTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-784s21c1
Sequence:CCGGATGTTCTGCCAAGCTATTATACTCGAGTATAATAGCTTGGCAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-447s21c1
Sequence:CCGGGGATGAGACTGTATGGACAAACTCGAGTTTGTCCATACAGTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097643
TAS2R30 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 30
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-182s21c1
Sequence:CCGGTGTTATTACTACATTGGTATGCTCGAGCATACCAATGTAGTAATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-730s21c1
Sequence:CCGGTCCATGATCATATCAGTTTGTCTCGAGACAAACTGATATGATCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-519s21c1
Sequence:CCGGCCATTCAAATATGACTCTAACCTCGAGGTTAGAGTCATATTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-784s21c1
Sequence:CCGGATGTTCTGCCAAGCTATTATACTCGAGTATAATAGCTTGGCAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097643.1-447s21c1
Sequence:CCGGGGATGAGACTGTATGGACAAACTCGAGTTTGTCCATACAGTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks