EMAIL THIS PAGE TO A FRIEND

TAS2R31

taste receptor, type 2, member 31

Synonyms: T2R31 T2R44 T2R53 TAS2R44
Species: Human TAS2R31(259290)
UniProtKB ID: P59538, P59547, Q17R84, Q645X5
Gene ID:
Human(259290) Summary: TAS2R44 belongs to the large TAS2R receptor family. TAS2Rs are expressed on the surface of taste receptor cells and mediate the perception of bitterness through a G protein-coupled second messenger pathway (Conte et al., 2002 [PubMed 12584440]
11 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302030 ANTI-TAS2R31 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176885 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176885 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062265 predicted 700
2 SASI_Hs01_00062266 predicted 92
3 SASI_Hs01_00062267 predicted 722
4 SASI_Hs01_00062268 predicted 719
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176885
TAS2R31 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 31
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176885.2-367s21c1
Sequence:CCGGGCTACTAGCCTCAGCATATTTCTCGAGAAATATGCTGAGGCTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176885.2-404s21c1
Sequence:CCGGCCAATTTCTCCAACCTTATTTCTCGAGAAATAAGGTTGGAGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176885.2-554s21c1
Sequence:CCGGACTTGACTTGGAAGATCAAATCTCGAGATTTGATCTTCCAAGTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-29s1c1
Sequence:CCGGCCAGTGTGGTAGTGGTTCTATCTCGAGATAGAACCACTACCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-715s1c1
Sequence:CCGGGCCGTTTACTTTCTGTCCATACTCGAGTATGGACAGAAAGTAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-34s1c1
Sequence:CCGGGTGGTAGTGGTTCTATTTGTTCTCGAGAACAAATAGAACCACTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-543s1c1
Sequence:CCGGGCTAGGAAACTTAGTGCCCTTCTCGAGAAGGGCACTAAGTTTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-702s1c1
Sequence:CCGGCCTCTTGTTATGTGCCGTTTACTCGAGTAAACGGCACATAACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176885
TAS2R31 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 31
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176885.2-367s21c1
Sequence:CCGGGCTACTAGCCTCAGCATATTTCTCGAGAAATATGCTGAGGCTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176885.2-404s21c1
Sequence:CCGGCCAATTTCTCCAACCTTATTTCTCGAGAAATAAGGTTGGAGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176885.2-554s21c1
Sequence:CCGGACTTGACTTGGAAGATCAAATCTCGAGATTTGATCTTCCAAGTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-29s1c1
Sequence:CCGGCCAGTGTGGTAGTGGTTCTATCTCGAGATAGAACCACTACCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-715s1c1
Sequence:CCGGGCCGTTTACTTTCTGTCCATACTCGAGTATGGACAGAAAGTAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-34s1c1
Sequence:CCGGGTGGTAGTGGTTCTATTTGTTCTCGAGAACAAATAGAACCACTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-543s1c1
Sequence:CCGGGCTAGGAAACTTAGTGCCCTTCTCGAGAAGGGCACTAAGTTTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-702s1c1
Sequence:CCGGCCTCTTGTTATGTGCCGTTTACTCGAGTAAACGGCACATAACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176885
TAS2R31 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 31
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176885.2-367s21c1
Sequence:CCGGGCTACTAGCCTCAGCATATTTCTCGAGAAATATGCTGAGGCTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176885.2-404s21c1
Sequence:CCGGCCAATTTCTCCAACCTTATTTCTCGAGAAATAAGGTTGGAGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176885.2-554s21c1
Sequence:CCGGACTTGACTTGGAAGATCAAATCTCGAGATTTGATCTTCCAAGTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-29s1c1
Sequence:CCGGCCAGTGTGGTAGTGGTTCTATCTCGAGATAGAACCACTACCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-715s1c1
Sequence:CCGGGCCGTTTACTTTCTGTCCATACTCGAGTATGGACAGAAAGTAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-34s1c1
Sequence:CCGGGTGGTAGTGGTTCTATTTGTTCTCGAGAACAAATAGAACCACTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-543s1c1
Sequence:CCGGGCTAGGAAACTTAGTGCCCTTCTCGAGAAGGGCACTAAGTTTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176885.1-702s1c1
Sequence:CCGGCCTCTTGTTATGTGCCGTTTACTCGAGTAAACGGCACATAACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks