EMAIL THIS PAGE TO A FRIEND

TAS2R38

taste receptor, type 2, member 38

Synonyms: PTC T2R38 T2R61
UniProtKB ID: P59533, A4D1U6, P59552, Q2M3E8, Q645W3, Q86UK3
Gene ID:
Human(5726) Summary: This gene encodes a seven-transmembrane G protein-coupled receptor that controls the ability to taste glucosinolates, a family of bitter-tasting compounds found in plants of the Brassica sp. Synthetic compounds phenylthiocarbamide (PTC) and 6-n-propylthiouracil (PROP) have been identified as ligands for this receptor and have been used to test the genetic diversity of this gene. Although several allelic forms of this gene have been identified worldwide, there are two predominant common forms (taster and non-taster) found outside of Africa. These alleles differ at three nucleotide positions resulting in amino acid changes in the protein (A49P, A262V, and V296I) with the amino acid combination PAV identifying the taster variant (and AVI identifying the non-taster variant). [provided by RefSeq, Oct 2009]
dog(100271737) taste receptor, type 2, member 38
cow(787789) taste receptor, type 2, member 38
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176817 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155201 MISSION® esiRNA esiRNA human TAS2R38 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176817 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131605 predicted 890
2 SASI_Hs01_00131606 predicted 743
3 SASI_Hs01_00131607 predicted 587
4 SASI_Hs01_00131608 predicted 591
5 SASI_Hs01_00131609 predicted 223
6 SASI_Hs01_00131610 predicted 600
7 SASI_Hs01_00131611 predicted 440
8 SASI_Hs01_00131613 predicted 807
9 SASI_Hs01_00131614 predicted 586
10 SASI_Hs02_00369242 predicted 551
11 SASI_Hs01_00131612 predicted 736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176817
TAS2R38 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 38
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176817.1-32s1c1
Sequence:CCGGCCTATGAAGTCAGGAGTACATCTCGAGATGTACTCCTGACTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176817.1-231s1c1
Sequence:CCGGGCTTACCCACTTCCAGAAGTTCTCGAGAACTTCTGGAAGTGGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176817.1-345s1c1
Sequence:CCGGGCTTTACTGCTCCAAGCTCATCTCGAGATGAGCTTGGAGCAGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176817.1-722s1c1
Sequence:CCGGCCCACATTAAAGCCCTCAAGTCTCGAGACTTGAGGGCTTTAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176817.3-756s21c1
Sequence:CCGGGAGGACAATGAAGGTCTATACCTCGAGGTATAGACCTTCATTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176817.3-625s21c1
Sequence:CCGGAGGCTCAACTGGCAGATTAAACTCGAGTTTAATCTGCCAGTTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176817.3-922s21c1
Sequence:CCGGATGGTTTGTGTTGGGATAATGCTCGAGCATTATCCCAACACAAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176817.3-507s21c1
Sequence:CCGGCCAGATGCTCCTGGGTATTATCTCGAGATAATACCCAGGAGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176817
TAS2R38 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 38
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176817.1-32s1c1
Sequence:CCGGCCTATGAAGTCAGGAGTACATCTCGAGATGTACTCCTGACTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176817.1-231s1c1
Sequence:CCGGGCTTACCCACTTCCAGAAGTTCTCGAGAACTTCTGGAAGTGGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176817.1-345s1c1
Sequence:CCGGGCTTTACTGCTCCAAGCTCATCTCGAGATGAGCTTGGAGCAGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176817.1-722s1c1
Sequence:CCGGCCCACATTAAAGCCCTCAAGTCTCGAGACTTGAGGGCTTTAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176817.3-756s21c1
Sequence:CCGGGAGGACAATGAAGGTCTATACCTCGAGGTATAGACCTTCATTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176817.3-625s21c1
Sequence:CCGGAGGCTCAACTGGCAGATTAAACTCGAGTTTAATCTGCCAGTTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176817.3-922s21c1
Sequence:CCGGATGGTTTGTGTTGGGATAATGCTCGAGCATTATCCCAACACAAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176817.3-507s21c1
Sequence:CCGGCCAGATGCTCCTGGGTATTATCTCGAGATAATACCCAGGAGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176817
TAS2R38 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 38
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176817.1-32s1c1
Sequence:CCGGCCTATGAAGTCAGGAGTACATCTCGAGATGTACTCCTGACTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176817.1-231s1c1
Sequence:CCGGGCTTACCCACTTCCAGAAGTTCTCGAGAACTTCTGGAAGTGGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176817.1-345s1c1
Sequence:CCGGGCTTTACTGCTCCAAGCTCATCTCGAGATGAGCTTGGAGCAGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176817.1-722s1c1
Sequence:CCGGCCCACATTAAAGCCCTCAAGTCTCGAGACTTGAGGGCTTTAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176817.3-756s21c1
Sequence:CCGGGAGGACAATGAAGGTCTATACCTCGAGGTATAGACCTTCATTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176817.3-625s21c1
Sequence:CCGGAGGCTCAACTGGCAGATTAAACTCGAGTTTAATCTGCCAGTTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176817.3-922s21c1
Sequence:CCGGATGGTTTGTGTTGGGATAATGCTCGAGCATTATCCCAACACAAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176817.3-507s21c1
Sequence:CCGGCCAGATGCTCCTGGGTATTATCTCGAGATAATACCCAGGAGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks