EMAIL THIS PAGE TO A FRIEND

TAS2R39

taste receptor, type 2, member 39

Synonyms: T2R39 T2R57
UniProtKB ID: P59534, A4FUI7, Q3ZCN6, Q645W4
Gene ID:
cow(530866) taste receptor, type 2, member 39
dog(100271735) taste receptor, type 2, member 39
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176881 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176881 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176881 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176881 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041189 predicted 502
2 SASI_Hs01_00041191 predicted 524
3 SASI_Hs01_00041192 predicted 392
4 SASI_Hs01_00041193 predicted 525
5 SASI_Hs01_00041194 predicted 280
6 SASI_Hs01_00041195 predicted 569
7 SASI_Hs02_00369266 predicted 281
8 SASI_Hs01_00041187 predicted 434
9 SASI_Hs01_00041188 predicted 777
10 SASI_Hs01_00041190 predicted 201
11 SASI_Hs01_00041196 predicted 476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176881
TAS2R39 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 39
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176881.2-40s21c1
Sequence:CCGGCAACAGCTCAGAATGACTAAACTCGAGTTTAGTCATTCTGAGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176881.2-596s21c1
Sequence:CCGGCATACTTGTCTGAGATCAATGCTCGAGCATTGATCTCAGACAAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176881.2-539s21c1
Sequence:CCGGGCACTGTGTATTGTAACAATTCTCGAGAATTGTTACAATACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-90s1c1
Sequence:CCGGGCCATTTCTCATCACCTTAATCTCGAGATTAAGGTGATGAGAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-453s1c1
Sequence:CCGGGTGGAGAATTACTGGATTGATCTCGAGATCAATCCAGTAATTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-241s1c1
Sequence:CCGGGTATCCAGAATAGCTCTCCAACTCGAGTTGGAGAGCTATTCTGGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-843s1c1
Sequence:CCGGCCTGTCCAACATGTTTGACATCTCGAGATGTCAAACATGTTGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-787s1c1
Sequence:CCGGGCTATCAGCTACTTTCTCATTCTCGAGAATGAGAAAGTAGCTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176881
TAS2R39 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 39
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176881.2-40s21c1
Sequence:CCGGCAACAGCTCAGAATGACTAAACTCGAGTTTAGTCATTCTGAGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176881.2-596s21c1
Sequence:CCGGCATACTTGTCTGAGATCAATGCTCGAGCATTGATCTCAGACAAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176881.2-539s21c1
Sequence:CCGGGCACTGTGTATTGTAACAATTCTCGAGAATTGTTACAATACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-90s1c1
Sequence:CCGGGCCATTTCTCATCACCTTAATCTCGAGATTAAGGTGATGAGAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-453s1c1
Sequence:CCGGGTGGAGAATTACTGGATTGATCTCGAGATCAATCCAGTAATTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-241s1c1
Sequence:CCGGGTATCCAGAATAGCTCTCCAACTCGAGTTGGAGAGCTATTCTGGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-843s1c1
Sequence:CCGGCCTGTCCAACATGTTTGACATCTCGAGATGTCAAACATGTTGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-787s1c1
Sequence:CCGGGCTATCAGCTACTTTCTCATTCTCGAGAATGAGAAAGTAGCTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176881
TAS2R39 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 39
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176881.2-40s21c1
Sequence:CCGGCAACAGCTCAGAATGACTAAACTCGAGTTTAGTCATTCTGAGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176881.2-596s21c1
Sequence:CCGGCATACTTGTCTGAGATCAATGCTCGAGCATTGATCTCAGACAAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176881.2-539s21c1
Sequence:CCGGGCACTGTGTATTGTAACAATTCTCGAGAATTGTTACAATACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-90s1c1
Sequence:CCGGGCCATTTCTCATCACCTTAATCTCGAGATTAAGGTGATGAGAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-453s1c1
Sequence:CCGGGTGGAGAATTACTGGATTGATCTCGAGATCAATCCAGTAATTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-241s1c1
Sequence:CCGGGTATCCAGAATAGCTCTCCAACTCGAGTTGGAGAGCTATTCTGGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-843s1c1
Sequence:CCGGCCTGTCCAACATGTTTGACATCTCGAGATGTCAAACATGTTGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176881.1-787s1c1
Sequence:CCGGGCTATCAGCTACTTTCTCATTCTCGAGAATGAGAAAGTAGCTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks