EMAIL THIS PAGE TO A FRIEND

TAS2R3

taste receptor, type 2, member 3

Synonyms: T2R3
UniProtKB ID: Q9NYW6, A4D1U2, Q645W2, Q75MV6
Gene ID:
Human(50831) Summary: This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily and that are specifically expressed by taste receptor cells of the tongue and palate epithelia. These apparently intronless taste receptor genes encode a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes in chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008]
Zebrafish(795861) taste receptor, type 2, member 3
dog(100271736) taste receptor, type 2, member 3
cow(664645) taste receptor, type 2, member 3
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016943 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016943 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119708 predicted 285
2 SASI_Hs01_00119709 predicted 435
3 SASI_Hs01_00119710 predicted 440
4 SASI_Hs01_00119711 predicted 480
5 SASI_Hs01_00119712 predicted 491
6 SASI_Hs01_00119713 predicted 231
7 SASI_Hs01_00119714 predicted 359
8 SASI_Hs01_00119715 predicted 509
9 SASI_Hs01_00119716 predicted 225
10 SASI_Hs01_00119717 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016943
TAS2R3 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016943.2-214s21c1
Sequence:CCGGTGGCACTCTTGAGGATCATTCCTCGAGGAATGATCCTCAAGAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016943.2-857s21c1
Sequence:CCGGTAAGATGATTGGCGAAGTAATCTCGAGATTACTTCGCCAATCATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016943.2-286s21c1
Sequence:CCGGCACATGATTCAGGGATAATAACTCGAGTTATTATCCCTGAATCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-793s1c1
Sequence:CCGGGCTAAGATGATTGGCGAAGTACTCGAGTACTTCGCCAATCATCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-696s1c1
Sequence:CCGGCATCAGAATCATCCTTTCCTTCTCGAGAAGGAAAGGATGATTCTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-526s1c1
Sequence:CCGGAGTGAGTATTATCTGATCCATCTCGAGATGGATCAGATAATACTCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-42s1c1
Sequence:CCGGCACTCAGTTCACACTGGGAATCTCGAGATTCCCAGTGTGAACTGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-101s1c1
Sequence:CCGGGCTGGTTCAAGACCAAGAGAACTCGAGTTCTCTTGGTCTTGAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016943
TAS2R3 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016943.2-214s21c1
Sequence:CCGGTGGCACTCTTGAGGATCATTCCTCGAGGAATGATCCTCAAGAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016943.2-857s21c1
Sequence:CCGGTAAGATGATTGGCGAAGTAATCTCGAGATTACTTCGCCAATCATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016943.2-286s21c1
Sequence:CCGGCACATGATTCAGGGATAATAACTCGAGTTATTATCCCTGAATCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-793s1c1
Sequence:CCGGGCTAAGATGATTGGCGAAGTACTCGAGTACTTCGCCAATCATCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-696s1c1
Sequence:CCGGCATCAGAATCATCCTTTCCTTCTCGAGAAGGAAAGGATGATTCTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-526s1c1
Sequence:CCGGAGTGAGTATTATCTGATCCATCTCGAGATGGATCAGATAATACTCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-42s1c1
Sequence:CCGGCACTCAGTTCACACTGGGAATCTCGAGATTCCCAGTGTGAACTGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-101s1c1
Sequence:CCGGGCTGGTTCAAGACCAAGAGAACTCGAGTTCTCTTGGTCTTGAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016943
TAS2R3 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016943.2-214s21c1
Sequence:CCGGTGGCACTCTTGAGGATCATTCCTCGAGGAATGATCCTCAAGAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016943.2-857s21c1
Sequence:CCGGTAAGATGATTGGCGAAGTAATCTCGAGATTACTTCGCCAATCATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016943.2-286s21c1
Sequence:CCGGCACATGATTCAGGGATAATAACTCGAGTTATTATCCCTGAATCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-793s1c1
Sequence:CCGGGCTAAGATGATTGGCGAAGTACTCGAGTACTTCGCCAATCATCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-696s1c1
Sequence:CCGGCATCAGAATCATCCTTTCCTTCTCGAGAAGGAAAGGATGATTCTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-526s1c1
Sequence:CCGGAGTGAGTATTATCTGATCCATCTCGAGATGGATCAGATAATACTCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-42s1c1
Sequence:CCGGCACTCAGTTCACACTGGGAATCTCGAGATTCCCAGTGTGAACTGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016943.1-101s1c1
Sequence:CCGGGCTGGTTCAAGACCAAGAGAACTCGAGTTCTCTTGGTCTTGAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks