EMAIL THIS PAGE TO A FRIEND

TAS2R40

taste receptor, type 2, member 40

Synonyms: GPR60 T2R40 T2R58
UniProtKB ID: P59535, A4D2I2, Q645W6
Gene ID:
dog(608842) taste receptor, type 2, member 40
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176882 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176882 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196751 predicted 244
2 SASI_Hs01_00196752 predicted 531
3 SASI_Hs01_00196753 predicted 499
4 SASI_Hs01_00196754 predicted 442
5 SASI_Hs01_00196755 predicted 303
6 SASI_Hs01_00196756 predicted 233
7 SASI_Hs01_00196757 predicted 742
8 SASI_Hs01_00196758 predicted 232
9 SASI_Hs01_00196760 predicted 468
10 SASI_Hs02_00369267 predicted 471
11 SASI_Hs01_00196759 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176882
TAS2R40 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 40
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176882.1-552s21c1
Sequence:CCGGGTACTTCTCTGAGACCAATATCTCGAGATATTGGTCTCAGAGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176882.1-61s21c1
Sequence:CCGGACTTTGGTGGTCTCCGGAATACTCGAGTATTCCGGAGACCACCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-242s1c1
Sequence:CCGGGTCTGCTATTCCGAATTGTTTCTCGAGAAACAATTCGGAATAGCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-499s1c1
Sequence:CCGGGTGTATGTGAATAGCTCCATTCTCGAGAATGGAGCTATTCACATACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-197s1c1
Sequence:CCGGCCAGGCTCTTGCTACAGATTTCTCGAGAAATCTGTAGCAAGAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-800s1c1
Sequence:CCGGCGTCCAACATCTTTGACACTTCTCGAGAAGTGTCAAAGATGTTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-304s1c1
Sequence:CCGGGTCTTTCTGAACCATTCCAATCTCGAGATTGGAATGGTTCAGAAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176882
TAS2R40 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 40
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176882.1-552s21c1
Sequence:CCGGGTACTTCTCTGAGACCAATATCTCGAGATATTGGTCTCAGAGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176882.1-61s21c1
Sequence:CCGGACTTTGGTGGTCTCCGGAATACTCGAGTATTCCGGAGACCACCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-242s1c1
Sequence:CCGGGTCTGCTATTCCGAATTGTTTCTCGAGAAACAATTCGGAATAGCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-499s1c1
Sequence:CCGGGTGTATGTGAATAGCTCCATTCTCGAGAATGGAGCTATTCACATACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-197s1c1
Sequence:CCGGCCAGGCTCTTGCTACAGATTTCTCGAGAAATCTGTAGCAAGAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-800s1c1
Sequence:CCGGCGTCCAACATCTTTGACACTTCTCGAGAAGTGTCAAAGATGTTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-304s1c1
Sequence:CCGGGTCTTTCTGAACCATTCCAATCTCGAGATTGGAATGGTTCAGAAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176882
TAS2R40 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 40
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176882.1-552s21c1
Sequence:CCGGGTACTTCTCTGAGACCAATATCTCGAGATATTGGTCTCAGAGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176882.1-61s21c1
Sequence:CCGGACTTTGGTGGTCTCCGGAATACTCGAGTATTCCGGAGACCACCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-242s1c1
Sequence:CCGGGTCTGCTATTCCGAATTGTTTCTCGAGAAACAATTCGGAATAGCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-499s1c1
Sequence:CCGGGTGTATGTGAATAGCTCCATTCTCGAGAATGGAGCTATTCACATACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-197s1c1
Sequence:CCGGCCAGGCTCTTGCTACAGATTTCTCGAGAAATCTGTAGCAAGAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-800s1c1
Sequence:CCGGCGTCCAACATCTTTGACACTTCTCGAGAAGTGTCAAAGATGTTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176882.1-304s1c1
Sequence:CCGGGTCTTTCTGAACCATTCCAATCTCGAGATTGGAATGGTTCAGAAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks