EMAIL THIS PAGE TO A FRIEND

TAS2R41

taste receptor, type 2, member 41

Synonyms: T2R41 T2R59
Gene ID:
dog(482734) taste receptor, type 2, member 41
cow(785715) taste receptor, type 2, member 41
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176883 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176883 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176883 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176883 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142185 predicted 489
2 SASI_Hs01_00142186 predicted 412
3 SASI_Hs01_00142187 predicted 582
4 SASI_Hs01_00142188 predicted 301
5 SASI_Hs01_00142190 predicted 623
6 SASI_Hs01_00142191 predicted 523
7 SASI_Hs01_00142192 predicted 446
8 SASI_Hs01_00142193 predicted 392
9 SASI_Hs01_00142194 predicted 322
10 SASI_Hs02_00369268 predicted 495
11 SASI_Hs01_00142189 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176883
TAS2R41 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 41
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-126s1c1
Sequence:CCGGGCCCTTGGATATGATCCTCATCTCGAGATGAGGATCATATCCAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-456s1c1
Sequence:CCGGCTACCCTGTATATCAAGAATTCTCGAGAATTCTTGATATACAGGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-621s1c1
Sequence:CCGGGAGGAGGCATACTCAGAGAATCTCGAGATTCTCTGAGTATGCCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-747s1c1
Sequence:CCGGCCTGATCATTGATGCCGCAAACTCGAGTTTGCGGCATCAATGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-589s1c1
Sequence:CCGGCTGGTCTCAATTATGCTGTTACTCGAGTAACAGCATAATTGAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176883
TAS2R41 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 41
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-126s1c1
Sequence:CCGGGCCCTTGGATATGATCCTCATCTCGAGATGAGGATCATATCCAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-456s1c1
Sequence:CCGGCTACCCTGTATATCAAGAATTCTCGAGAATTCTTGATATACAGGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-621s1c1
Sequence:CCGGGAGGAGGCATACTCAGAGAATCTCGAGATTCTCTGAGTATGCCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-747s1c1
Sequence:CCGGCCTGATCATTGATGCCGCAAACTCGAGTTTGCGGCATCAATGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-589s1c1
Sequence:CCGGCTGGTCTCAATTATGCTGTTACTCGAGTAACAGCATAATTGAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176883
TAS2R41 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 41
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-126s1c1
Sequence:CCGGGCCCTTGGATATGATCCTCATCTCGAGATGAGGATCATATCCAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-456s1c1
Sequence:CCGGCTACCCTGTATATCAAGAATTCTCGAGAATTCTTGATATACAGGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-621s1c1
Sequence:CCGGGAGGAGGCATACTCAGAGAATCTCGAGATTCTCTGAGTATGCCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-747s1c1
Sequence:CCGGCCTGATCATTGATGCCGCAAACTCGAGTTTGCGGCATCAATGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176883.1-589s1c1
Sequence:CCGGCTGGTCTCAATTATGCTGTTACTCGAGTAACAGCATAATTGAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks