EMAIL THIS PAGE TO A FRIEND

TAS2R42

taste receptor, type 2, member 42

Synonyms: T2R24 T2R55 TAS2R55 hT2R55
UniProtKB ID: Q7RTR8, A2RRP4, Q645X0
Gene ID:
cow(664646) taste receptor, type 2, member 42
cow(100140395) taste receptor, type 2, member 42
dog(100271731) taste receptor, type 2, member 42
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181429 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181429 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180145 predicted 458
2 SASI_Hs01_00180146 predicted 517
3 SASI_Hs01_00180147 predicted 368
4 SASI_Hs01_00180148 predicted 381
5 SASI_Hs02_00370049 predicted 229
6 SASI_Hs01_00180149 predicted 291
7 SASI_Hs02_00370050 predicted 250
8 SASI_Hs01_00180152 predicted 483
9 SASI_Hs01_00180153 predicted 383
10 SASI_Hs01_00180154 predicted 425
11 SASI_Hs01_00180150 predicted 214
12 SASI_Hs01_00180151 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181429
TAS2R42 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 42
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-617s1c1
Sequence:CCGGCCTTGGTGAGACATACTAGAACTCGAGTTCTAGTATGTCTCACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-780s1c1
Sequence:CCGGGTGGAACAACAAGTACATAAACTCGAGTTTATGTACTTGTTGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-175s1c1
Sequence:CCGGCTGTTGGTGATACTGTTTGATCTCGAGATCAAACAGTATCACCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-370s1c1
Sequence:CCGGTGGAGGATGAACGGAATGATTCTCGAGAATCATTCCGTTCATCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-430s1c1
Sequence:CCGGGACAGTTTAGTGCTAGAAATACTCGAGTATTTCTAGCACTAAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181429.1-720s21c1
Sequence:CCGGTTTCCTCTTCATAGTTCATTTCTCGAGAAATGAACTATGAAGAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181429.1-520s21c1
Sequence:CCGGCTCTATGATAAACTCTCTATTCTCGAGAATAGAGAGTTTATCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181429
TAS2R42 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 42
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-617s1c1
Sequence:CCGGCCTTGGTGAGACATACTAGAACTCGAGTTCTAGTATGTCTCACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-780s1c1
Sequence:CCGGGTGGAACAACAAGTACATAAACTCGAGTTTATGTACTTGTTGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-175s1c1
Sequence:CCGGCTGTTGGTGATACTGTTTGATCTCGAGATCAAACAGTATCACCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-370s1c1
Sequence:CCGGTGGAGGATGAACGGAATGATTCTCGAGAATCATTCCGTTCATCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-430s1c1
Sequence:CCGGGACAGTTTAGTGCTAGAAATACTCGAGTATTTCTAGCACTAAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181429.1-720s21c1
Sequence:CCGGTTTCCTCTTCATAGTTCATTTCTCGAGAAATGAACTATGAAGAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181429.1-520s21c1
Sequence:CCGGCTCTATGATAAACTCTCTATTCTCGAGAATAGAGAGTTTATCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181429
TAS2R42 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 42
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-617s1c1
Sequence:CCGGCCTTGGTGAGACATACTAGAACTCGAGTTCTAGTATGTCTCACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-780s1c1
Sequence:CCGGGTGGAACAACAAGTACATAAACTCGAGTTTATGTACTTGTTGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-175s1c1
Sequence:CCGGCTGTTGGTGATACTGTTTGATCTCGAGATCAAACAGTATCACCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-370s1c1
Sequence:CCGGTGGAGGATGAACGGAATGATTCTCGAGAATCATTCCGTTCATCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181429.1-430s1c1
Sequence:CCGGGACAGTTTAGTGCTAGAAATACTCGAGTATTTCTAGCACTAAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181429.1-720s21c1
Sequence:CCGGTTTCCTCTTCATAGTTCATTTCTCGAGAAATGAACTATGAAGAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181429.1-520s21c1
Sequence:CCGGCTCTATGATAAACTCTCTATTCTCGAGAATAGAGAGTTTATCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks