EMAIL THIS PAGE TO A FRIEND

TAS2R43

taste receptor, type 2, member 43

Synonyms: T2R43 T2R52
Species: Human TAS2R43(259289)
UniProtKB ID: P59537, P59546, Q645X4
Gene ID:
Human(259289) Summary: TAS2R43 belongs to the large TAS2R receptor family. TAS2Rs are expressed on the surface of taste receptor cells and mediate the perception of bitterness through a G protein-coupled second messenger pathway (Conte et al., 2002 [PubMed 12584440]
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306721 ANTI-TAS2R43 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176884 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176884 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166235 predicted 528
2 SASI_Hs01_00166234 predicted 431
3 SASI_Hs01_00166236 predicted 707
4 SASI_Hs01_00166237 predicted 288
5 SASI_Hs01_00166238 predicted 633
6 SASI_Hs01_00166239 predicted 265
7 SASI_Hs01_00166240 predicted 490
8 SASI_Hs01_00166241 predicted 377
9 SASI_Hs01_00166242 predicted 717
10 SASI_Hs01_00166243 predicted 99
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176884
TAS2R43 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 43
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-648s21c1
Sequence:CCGGCACTCTGACCCTACTATCTTTCTCGAGAAAGATAGTAGGGTCAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-667s21c1
Sequence:CCGGTTTATGCTGTTAATCTGTTCTCTCGAGAGAACAGATTAACAGCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-685s21c1
Sequence:CCGGTCTTTGTGTAAACATCTCAAGCTCGAGCTTGAGATGTTTACACAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-611s21c1
Sequence:CCGGATATGACTGTAACCATGGTAGCTCGAGCTACCATGGTTACAGTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-531s21c1
Sequence:CCGGGAATGAGATTGTGCGGACAAACTCGAGTTTGTCCGCACAATCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-775s1c1
Sequence:CCGGCCTGTCTTCATGTTCTGCAAACTCGAGTTTGCAGAACATGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-29s1c1
Sequence:CCGGCCAGTCTGGTAGTGGTTACATCTCGAGATGTAACCACTACCAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-495s1c1
Sequence:CCGGGATCAAATTGAAGAGTGCAATCTCGAGATTGCACTCTTCAATTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-331s1c1
Sequence:CCGGGCCAATTTCTCCAACTTTATTCTCGAGAATAAAGTTGGAGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-74s1c1
Sequence:CCGGGCTTCATAGCACTGGTAAATTCTCGAGAATTTACCAGTGCTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176884
TAS2R43 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 43
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-648s21c1
Sequence:CCGGCACTCTGACCCTACTATCTTTCTCGAGAAAGATAGTAGGGTCAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-667s21c1
Sequence:CCGGTTTATGCTGTTAATCTGTTCTCTCGAGAGAACAGATTAACAGCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-685s21c1
Sequence:CCGGTCTTTGTGTAAACATCTCAAGCTCGAGCTTGAGATGTTTACACAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-611s21c1
Sequence:CCGGATATGACTGTAACCATGGTAGCTCGAGCTACCATGGTTACAGTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-531s21c1
Sequence:CCGGGAATGAGATTGTGCGGACAAACTCGAGTTTGTCCGCACAATCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-775s1c1
Sequence:CCGGCCTGTCTTCATGTTCTGCAAACTCGAGTTTGCAGAACATGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-29s1c1
Sequence:CCGGCCAGTCTGGTAGTGGTTACATCTCGAGATGTAACCACTACCAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-495s1c1
Sequence:CCGGGATCAAATTGAAGAGTGCAATCTCGAGATTGCACTCTTCAATTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-331s1c1
Sequence:CCGGGCCAATTTCTCCAACTTTATTCTCGAGAATAAAGTTGGAGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-74s1c1
Sequence:CCGGGCTTCATAGCACTGGTAAATTCTCGAGAATTTACCAGTGCTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176884
TAS2R43 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 43
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-648s21c1
Sequence:CCGGCACTCTGACCCTACTATCTTTCTCGAGAAAGATAGTAGGGTCAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-667s21c1
Sequence:CCGGTTTATGCTGTTAATCTGTTCTCTCGAGAGAACAGATTAACAGCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-685s21c1
Sequence:CCGGTCTTTGTGTAAACATCTCAAGCTCGAGCTTGAGATGTTTACACAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-611s21c1
Sequence:CCGGATATGACTGTAACCATGGTAGCTCGAGCTACCATGGTTACAGTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176884.2-531s21c1
Sequence:CCGGGAATGAGATTGTGCGGACAAACTCGAGTTTGTCCGCACAATCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-775s1c1
Sequence:CCGGCCTGTCTTCATGTTCTGCAAACTCGAGTTTGCAGAACATGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-29s1c1
Sequence:CCGGCCAGTCTGGTAGTGGTTACATCTCGAGATGTAACCACTACCAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-495s1c1
Sequence:CCGGGATCAAATTGAAGAGTGCAATCTCGAGATTGCACTCTTCAATTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-331s1c1
Sequence:CCGGGCCAATTTCTCCAACTTTATTCTCGAGAATAAAGTTGGAGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176884.1-74s1c1
Sequence:CCGGGCTTCATAGCACTGGTAAATTCTCGAGAATTTACCAGTGCTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks